Molecular and cytogenetic analysis

Published on 04/03/2015 by admin

Filed under Hematology, Oncology and Palliative Medicine

Last modified 22/04/2025

Print this page

rate 1 star rate 2 star rate 3 star rate 4 star rate 5 star
Your rating: none, Average: 0 (0 votes)

This article have been viewed 5445 times

[level-membership-for-hematology-oncology-and-palliative-medicine-category]

Chapter 8 Molecular and cytogenetic analysis

Introduction to the analysis of DNA

Our understanding of the molecular basis of both inherited and acquired haematological disorders is now considerable and there are several ways in which this knowledge is being applied in diagnostic haematology. These include the identification of genetic defects in haemoglobinopathies allowing the provision of early prenatal diagnosis, the assessment of genetic risk factors in thrombophilia, the diagnosis and characterization of leukaemias, the monitoring of minimal residual disease and the study of host–donor chimerism following bone marrow transplantation. In this chapter, we shall describe some of the methods that can be applied in these conditions, although this cannot be exhaustive and will reflect the specific interests of our laboratories.

The ability to manipulate DNA as recombinant molecules followed from the discovery of bacterial DNA-modifying enzymes that allowed genes to be isolated as cloned recombinant DNA molecules and their DNA to be sequenced. The sequence of the human genome is now complete (see: www.ornl.gov/sci/techresources/Human_Genome/project/timeline.shtml).1,2 It has become extensively annotated and is accessible through a number of genome browsers. The ability to amplify specific DNA fragments from small amounts of starting material using the polymerase chain reaction (PCR)3 is now the cornerstone of most routine DNA analysis. Because this technique is relatively simple, rapid, inexpensive and requires only some basic pieces of laboratory equipment, it has made molecular genetic analysis readily accessible in many laboratories.

Guidelines from the American Association for Molecular Pathology address the choice and development of appropriate diagnostic assays, quality control and validation and implementation of molecular diagnostic tests.4 In the UK, a national external quality assessment scheme has been approved for the molecular genetics of thrombophilia and pilot studies are currently in progress for the molecular diagnosis of haematological malignancies and for haemophilia A. It is true, however, that the development and implementation of quality control methods and assurance standards still lag behind the rapid rate of expansion of molecular techniques.5,6 To overcome this, both at national and international level, several groups are attempting to reach a standardization of molecular methodologies applied to fusion gene quantification (BCR–ABL1, PML–RARA, etc.) in myeloid malignancies as well as the molecular monitoring of residual disease using antigen receptor targets in acute and chronic lymphoid malignancies.

In this chapter, some of the applications of the PCR in a diagnostic haematology laboratory are described. For the reasons just mentioned, the analysis of PCR products has largely superseded other techniques, including Southern blot analysis, and capillary electrophoresis has replaced polyacrylamide gel electrophoresis. For situations in which these are still appropriate, the reader is referred to previous editions of this book.

Extraction of DNA

DNA can be extracted from blood, bone marrow or tissue samples. The quality and quantity of the DNA obtained will vary depending on the size, age and cell count of the sample. As a rule, 5–10 ml of blood in ethylenediaminetetra-acetic acid (EDTA) will suffice. The DNA is extracted from all nucleated cells and is called genomic DNA.

In the nucleus, the DNA is tightly associated with many different proteins as chromatin. It is important to remove these as well as other cellular proteins to extract the DNA. This is achieved through the use of organic solvents, salt precipitation or DNA-affinity columns. An aqueous solution of DNA is obtained, from which the DNA is further purified by precipitation. A number of DNA extraction kits have been developed. They are commercially available and cost-effective. In addition, equipment that can achieve simultaneous extraction from a large number of samples is available and will be discussed below. These can significantly reduce the amount of time required for DNA extraction, bypass the use of organic solvents and provide good quality control of the reagents used.

Polymerase chain reaction

Development of the PCR3 has had a dramatic impact on the study and analysis of nucleic acids. Through the use of a thermostable DNA polymerase, Taq polymerase (available from various suppliers, including Applied Biosystems, Warrington and Thermo-Fisher, Runcorn) extracted from the bacterium Thermus aquaticus, the PCR results in the amplification of a specific DNA fragment such that it can be visualized using intercalating SYBR Safe (Invitrogen, Paisley) added to agarose gels. Ethidium bromide, a carcinogenic product, is no longer in use for safety reasons. The procedure takes only a few hours and requires only a very small amount of starting material.

Principle

A DNA polymerase will synthesize the complementary strand of a DNA template in vitro. A stretch of double-stranded DNA is required for the synthesis to be initiated. This double-stranded sequence can be generated by annealing an oligonucleotide (oligo), which is a short, single-stranded DNA molecule usually between 17 and 22 bases in length, to a single-stranded DNA template. These oligos, which are synthesized in vitro, will prime the DNA synthesis and are therefore referred to as primers.

In the PCR, at least two oligos are used. One primes the synthesis of DNA in the forward direction or along the coding strand of the DNA, whereas the other primes DNA synthesis in the reverse direction or along the non-coding strand. The other components of the reaction are the DNA template from which the DNA fragment will be amplified, the four deoxynucleotide triphosphates (dATP, dTTP, dCTP and dGTP) required as the building blocks of the newly synthesized DNA, a salt buffer containing MgCl2 and the thermostable DNA polymerase (Taq polymerase).

The first step of the reaction is to denature the DNA, generating single-stranded templates, by heating the reaction mixture to 95°C. The reaction is then cooled to a temperature, usually between 50°C and 68°C, that permits the annealing of the primers to the DNA template but only at their specific complementary sequences. The temperature is then raised to 72°C, at which temperature the Taq polymerase efficiently synthesizes DNA, extending from the primers in a 5′ to 3′ direction. Cyclical repetition of the denaturing, annealing and extension steps, by simply changing the temperature of the reaction in an automated heating block, results in exponential amplification of the DNA that lies between the two primers (Fig. 8.1).

The specificity of the DNA fragment that is amplified is therefore determined by the sequences of the primers used. A sequence of 17–22 base pairs (bp) is statistically likely to be unique in the human genome and so primers of this length and longer will anneal at only one specific place on a template of genomic DNA. One general requirement of the PCR therefore is some knowledge of the DNA sequence of the gene that is to be amplified. The relative positioning of the two primers is another important consideration. They must anneal to complementary strands and must prime DNA synthesis in opposite directions pointing towards one another. There is also an upper limit to the distance apart that the oligos can be placed; fragments of several kilobase pairs (kb) in length can be amplified, but the process is most efficient for fragments of several hundred bp.

Reagents

Method

Optimal conditions for the reaction have to be derived empirically, with the magnesium concentration and annealing temperature being the most important parameters.7 The choice of buffer depends on the enzyme being used and the company will usually supply the most appropriate one. For genes with a high GC content, buffer II in combination with 10% DMSO may give better amplification. In most cases, a 25 μl reaction volume suffices. A blank control should always be included (i.e. a reaction without any template) to control for contamination. If the blank control yields a product, the analysis is invalid. A DNA sample that is known to amplify can also be included and this sample may then be used as a normal or positive control.

The risk of contamination cannot be overemphasized. It can be minimized by using plugged tips and having dedicated micropipettes and areas for each step of the analysis. The optimum cycling conditions need to be determined for each thermocycler. Specificity is often improved by ‘hot start’ PCR. This is achieved by setting up all the PCR tests on wet ice and transferring the tubes to the thermocycler once it reaches 95°C or by using an enzyme that only becomes activated when heated at 95°C for several minutes. In preparing a group of reactions, a premix solution is prepared that can be dispensed into microcentrifuge tubes, tube strips or PCR reaction 96-well plates to which the template DNA is added. When a particular PCR is to be performed repetitively over a period of time, it is helpful to prepare a large volume (e.g. 10 ml) of the reaction mixture (without DNA or Taq polymerase), aliquot it and store it at –20°C.

1. Prepare a PCR mixture for 20 reactions (with a final volume of 25 μl for each DNA sample) as follows:

Stock solution Volume (μl) Final concentration
×10 PCR buffer III 50 ×1
25 mmol/l MgCl2 40 2.0 mmol/l
10 mmol/l dNTP 10 0.02 mmol/l
10 μmol/l Primer (1) 20 0.04 μmol/l
10 μmol/l Primer (2) 20 0.04 μmol/l
5 u/μl Taq polymerase 2 0.02 μ/ml
Water 358  
Final volume 500  

Add the Taq polymerase last, mix well and pulse-spin in a microcentrifuge to bring down the contents of the tube.

Problems and Interpretation

If the amplification has been successful, a discrete fragment of the expected size is seen in an SYBR Safe-stained agarose gel in all samples, except where a blank control (in which the DNA template is replaced by water) is loaded. If a product is seen in the blank control, then one of the solutions has been contaminated. In this case, the experiment and all the working solutions must be discarded and the micropipettes must be cleaned. Cleaning micropipettes prior to the start of each experiment is highly recommended. To avoid contamination, setting up a master mix of all reagents is recommended before DNA samples are added to each tube.

Conversely, the absence of a fragment in all tracks indicates that the PCR has failed. This could occur for a number of reasons, the most obvious being the poor quality or omission of one of the essential reagents. The reaction may also fail if the magnesium concentration is too low (standard concentration 1.5 mM) or if the annealing temperature is too high. DNA quality is often one of the major reasons for failure. If one particular DNA sample repeatedly fails to amplify, then the sample should be re-extracted using Proteinase K (Sigma, Poole) and phenol and chloroform and reprecipitated in one-tenth volume of 5 mol/l ammonium acetate or 3M sodium acetate pH 4.8 and 2.5 volumes of ethanol. We have also found that for samples prepared using the Gentra method, passing the DNA through a Qiagen column substantially improves DNA quality and PCR efficiency. Another problem is the presence of non-specific fragments or just a smear of amplified product. This can occur if the magnesium concentration is too high or if the annealing temperature is too low.

Analysis of polymerase chain reaction products

Presence or Absence of a Polymerase Chain Reaction Product

Initially, PCR products are commonly and conveniently visualized by agarose gel electrophoresis. However, it has also become commonplace to visualize PCR products directly on DNA analysers – in particular the Applied Biosystems 3130xl (Warrington) – through the use of a fluorescent label on one of the primers. If appropriate primers and controls are included in an experiment, the actual presence of a product can be highly informative.

Amplification Refractory Mutation System

Principle

Point mutations and small insertions or deletions can be identified directly by the presence or absence of a PCR product using allele-specific primers.8,9 Two different oligos are used that differ only at the site of the mutation (the amplification refractory mutation system or ARMS, primers) with the mismatch distinguishing the normal and mutant base located at the 3′ end of the oligo. In a PCR, an oligo with a mismatch at its 3′ end will fail to prime the extension step of the reaction. Each test sample is amplified in two separate reactions containing either a mutant ARMS primer or a normal ARMS primer. The mutant primer will prime amplification together with one common primer from DNA with this mutation but not from a normal DNA. A normal primer will do the opposite. To increase the instability of the 3′ end mismatch and so ensure the failure of the amplification, it is sometimes necessary to introduce a second nucleotide mismatch three or four bases from the 3′ end of both oligos. A second pair of unrelated primers at a distance from the ARMS primers is included in each reaction as an internal control to demonstrate that efficient amplification has occurred. This is essential because a failure of the ARMS primer to amplify is interpreted as a significant result and must not be the result of suboptimal reaction conditions.

Gap-PCR

Large deletions can be detected by Gap-PCR. Primers located 5′ and 3′ to the breakpoints of a deletion will anneal too far apart on the normal chromosome to generate a fragment in a standard PCR. When the deletion is present, the sites at which these primers anneal will be brought together, enabling them to give rise to a product. An example of this is given for the detection of deletions in α° thalassaemia in Figure 8.4 on p. 149.

image

Figure 8.4 Detection of α° thalassaemia by multiplex Gap-PCR. The sequences of the primers used are shown in Table 8.1. A normal fragment of 1010 bp is generated by the primers α/SEA(F) and α/(R) in all lanes (although this is very faint in lane 11). In addition, a fragment of 660 bp is generated by the primer pair α/SEA(F) and SEA(R) in lanes 1, 4 and 8 in individuals who are heterozygous for the − −SEA deletion; a fragment of 550 bp is generated by the primer pair FIL(F) and FIL(R) in lane 9 in an individual who is heterozygous for the − −FIL deletion; a fragment of 875 bp is generated by the primer pair MED(F) and MED(R) in lane 10 in an individual who is heterozygous for the − −MED deletion; and a fragment of 1187 bp is generated by the primer pair 20.5(F) and 20.5(R) in lane 10 in an individual who is heterozygous for the −α20.5 deletion.

By the same principle, the sites at which primers anneal can be brought together by chromosomal translocation, giving rise to a diagnostic product. Breakpoints may be clustered over too large a region for genomic DNA to be used in these instances. However, leukaemic translocations can also give rise to transcribed fusion genes. Primer annealing sites in different genes are then juxtaposed in a hybrid messenger RNA (mRNA) molecule and can give rise to a reverse transcription-PCR (RT-PCR) product. Examples of this are given for the analysis of minimal residual disease in chronic myelogenous leukaemia (CML) in Figure 8.8 on p. 155.

image

Figure 8.8 Detection of minimal residual disease in chronic myelogenous leukaemia (CML) by reverse transcriptase-polymerase chain reaction (RT-PCR). (A) Diagrammatic representation of the processed exons of the BCR and ABL1 genes together with the relative position of the B2B and C5e-primers used to co-amplify BCR in the multiplex PCR. (B) Commonly observed BCR–ABL1 derivatives, b2a2 and b3a2 which give rise to p210 BCR–ABL1 and e1a2, which gives rise to p190 BCR–ABL1. The relative positions of the primers used to amplify the chimeric transcripts by multiplex PCR are shown. (C) A 2.0% agarose gel containing SYBR Safe dye through which amplicons generated by multiplex PCR using complementary DNA (cDNA) from five patients (lanes 1 to 5) were electrophoresed. The co-amplified normal BCR fragment, 808 bp in length, is seen in all samples except for the lanes containing the blank controls (B). The diagnostic sample from a patient with suspected CML, in lane 2, revealed a fragment corresponding to the b3a2 BCR–ABL1 transcript, 385 bp in length, in addition to the BCR amplicon. BCR–ABL1 is not detectable in lanes 1, 3, 4 and 5 containing follow-up samples from patients following stem cell transplantation (SCT). (D) The cDNA of these individuals was subjected to nested PCR to exclude residual disease. This reveals BCR–ABL1 transcripts, b3a2 (385 bp) and b2a2 (310 bp) in lanes 1 and 4, previously undetectable by the less sensitive multiplex PCR. However, BCR–ABL1 is not detectable in lanes 3 and 5, implying these samples are from patients in molecular remission post-SCT. B, blank controls; K (K562-b3a2) and BV (BV173-b2a2), positive controls; M, molecular size marker.

Restriction Enzyme Digestion

Reagents

A number of companies supply a comprehensive list of restriction enzymes (RE), including New England Biolabs (Hitchin) and Fermentas (York). Those that are in regular use are generally quite inexpensive compared with the more specialized enzymes that are used only occasionally, which may be 10–100 times more expensive. RE buffers are now almost always supplied with each RE. Buffer compositions are always given and will vary from enzyme to enzyme. Many commonly used REs cut perfectly well in a single ‘universal’ buffer. This is prepared using the following stock solutions:

Allele-Specific Oligonucleotide Hybridization

Principle

Under appropriate conditions, short oligonucleotide probes will hybridize to their exact complementary sequence but not to a sequence in which there is even a single base mismatch.10 A pair of oligos is therefore used to test for the presence of a point mutation: a mutant oligo complementary to the mutant sequence and a normal oligo complementary to the normal sequence, with the sequence difference placed near the centre of each oligo.

The stability of the duplex formed between the oligo and the target DNA being tested (the product of a PCR reaction) depends on the temperature, the base composition and length of the oligo and the ionic strength of the washing solution. For allele-specific oligonucleotide hybridization (ASOH) studies, an empirical formula has been derived for the dissociation temperature (Td), the temperature at which half of the duplexes are dissociated: for hybridization of oligonucleotides of 14–20 bases in length. The Td can be estimated as 2°C for each dA:dT pair plus 4°C for each dG:dC base pair. This value is used as a guideline; the exact temperature at which only perfect base pairing is maintained is usually determined by trial and error.

This methodology has been widely applied for the detection of point mutations using fluorescently labelled TaqMan probes that distinguish the two alleles. Two short allele-specific probes are used, one of which will hybridize only to the wild-type allele and one of which will hybridize only to the mutant allele. Each probe is labelled with a different fluorescent colour, which is quenched while the probe remains intact, but is released if and when the probe hybridizes to its perfectly complementary sequence during the PCR reaction, as it will then be broken up by the exonuclease activity of the Taq polymerase. An example of this analysis is the detection of the factor V Leiden mutation in Figure 8.5 on p. 150.

DNA Sequencing

Principle

The Sanger chain termination method for direct DNA sequencing has become a standard diagnostic tool. In many laboratories, this procedure has superseded targeted mutation detection as it provides a robust and relatively rapid method to identify all sequence changes that may be present in a particular DNA fragment. This approach is particularly relevant where multiple different mutations may underlie a particular disorder. This is the case for β thalassaemia, glucose-6-phosphate dehydrogenase (G6PD) deficiency and the red cell membrane disorders among others and so it is not surprising that DNA sequencing has often become the method of choice for the molecular diagnosis of these diseases.

In outline, the method revolves around the de novo synthesis of DNA strands in one direction from a PCR-derived template DNA fragment. The chain is lengthened by a thermostable DNA polymerase using deoxynucleotide triphosphates in the normal way; however, included in the reaction mixture is a small proportion of labelled dideoxynucleotide triphosphates (ddNTPs), which when incorporated will prevent any further extension of the chain. This process happens millions of times along a relatively short piece of DNA (usually up to 1000 bases), which means that chaintermination will occur many times at each position along the fragment. In the Applied Biosystems BigDye system (Warrington), each of the ddNTPs is labelled with a different fluorochrome and so the products of the sequencing reaction will consist of single-stranded DNA fragments, each differing in size by one base pair and each labelled with a different colour. These fragments can then be separated by capillary electrophoresis and the order with which the different colours exit the capillary will correspond to the sequence of the DNA template.

Interpretation

Reading the DNA sequence from a good trace – known as an electrophoretogram – is completely straightforward: As are called as green peaks; Ts as red; Cs as blue; and Gs as black. Free software packages, such as Chromas (at: http://chromas-lite-version.fyxm.net/), are available for viewing these traces and will call the DNA sequence in the file. Simple alignment of this sequence to the GenBank reference sequence can be performed at the National Center for Bioinformatics (NCBI) using the Blast program (at: http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome) and will identify any sequence changes. Heterozygous point mutations will be seen as double peaks, with two colours overlaid. Small heterozygous insertions or deletions (indels) are harder to decipher, as the sequence 3′ of the mutation will be a double sequence, with the normal and indel allele superimposed on one another: the extent of the indel can be defined by subtracting from the expected normal sequence.

Investigation of haemoglobinopathies

β Thalassaemia

The ethnic groups with the highest incidence of β thalassaemia are the Mediterranean populations, Asian Indians, Chinese and Africans. Although more than 100 β thalassaemia mutations are known, each of these groups has its own subset of mutations, so that as few as five different mutations may account for more than 90% of the affected individuals in a population. This makes the direct detection of β thalassaemia mutations a reasonable possibility and it has become the method of choice where it is most important: in prenatal diagnosis.13,14

The majority of mutations causing β thalassaemia are point mutations affecting the coding sequence, splice sites or promoter of the β globin gene. Methods for their detection include either ARMS or reverse dot blot analysis, although more commonly now, they are detected by direct DNA sequence analysis. Unstable and other unusual haemoglobins may also cause disease and can also be identified by direct DNA sequence analysis. An example of such a case is shown in Figure 8.3, where a picture of moderate anaemia is seen in the heterozygote due to the highly unstable and electrophoretically silent variant, haemoglobin, Durham, NC.

α Thalassaemia

In contrast to the β thalassaemias, the most common α thalassaemia mutations are deletions. Two categories exist: those that remove only one of the two alpha globin genes on any one chromosome (α+ thalassaemia) and those that remove both of the alpha genes from one chromosome (α° thalassaemia). Although PCR amplification around the alpha globin locus has proved to be rather difficult, the common deletions can now be identified by a reasonably robust Gap-PCR.15 In these reactions dimethylsulphoxide (DMSO) and betaine are added. Two different multiplex PCR reactions are set up, one for the common α+ thalassaemias (−α3.7 and −α4.2) and one for the common α° thalassaemias (− −SEA, − −MED, − −FIL and −α20.5). The fragment generated by these primers across the deletion breakpoint is different in size to a control fragment that is generated from the normal chromosome as a part of the multiplex reaction. The primers that flank the deletion breakpoint are too far apart to generate a fragment from the normal chromosome in the PCR. Only when these are brought closer together as a result of the deletion can a fragment be produced. Primer sequences used in this analysis are given in Table 8.1 and an example of their application in the detection of α thalassaemias is shown in Figure 8.4. More than 30 non-deletional forms of α thalassaemia have been described. Of these, Hb Constant Spring and the αHphIα mutation are relatively common in South-east Asian and Mediterranean populations, respectively. These can be detected by ASOH, ARMS, restriction enzyme digestion or direct sequencing of the appropriate PCR product. Unlike the β thalassaemias, α thalassaemias are not easily diagnosed using routine haematological techniques. The diagnosis of α thalassaemias is often made following exclusion of β thalassaemia and iron deficiency. Because the vast majority of cases of α thalassaemia are of the clinically benign type (i.e. α+ thalassaemia), it is debatable whether molecular analysis is justified to reach a diagnosis in these individuals. However, it is important that individuals with α° thalassaemia are identified and the only definitive diagnostic test is DNA analysis. The α° thalassaemias are almost entirely restricted to at-risk ethnic groups, particularly those of South-east Asian or Mediterranean origin and so it is most efficient to target these groups specifically. The diagnosis of α° thalassaemia is particularly relevant if prenatal diagnosis is to be offered to a couple who are at risk of having a fetus with hydrops, where there is an increased risk of maternal death at delivery. Guidelines derived from the UK experience as to how and when DNA analysis should be implemented have recently been updated.16

Table 8.1 Primers used in Gap-PCR analysis of α-thalassaemia

Primer name Sequence, 5′→3′ Concentration (μmol/l)
α° Multiplex PCR Clark and Thein (2004)14
20.5(F) GGGCAAGCTGGTGGTGTTACACAGCAACTC 0.1
20.5(R) CCACGCCCATGCCTGGCACGTTTGCTGAGG 0.1
α/SEA(F) CTCTGTGTTCTCAGTATTGGAGGGAAGGAG 0.3
α(R) TGAAGAGCCTGCAGGACCAGGTCAGTGACCG 0.15
MED(F) CGATGAGAACATAGTGAGCAGAATTGCAGG 0.15
MED(R) ACGCCGACGTTGCTGCCCAGCTTCTTCCAC 0.15
SEA(R) ATATATGGGTCTGGAAGTGTATCCCTCCCA 0.15
FIL(F) AAGAGAATAAACCACCCAATTTTTAAATGGGCA 1.6
FIL(R) GAGATAATAACCTTTATCTGCCACATGTAGCAA 1.6
α+ Multiplex PCR From JM Old (pers. comm.)
3.7F CCCCTCGCCAAGTCCACCC 0.4
3.7/20.5R AAAGCACTCTAGGGTCCAGCG 0.4
4.2F GGTTTACCCATGTGGTGCCTC 0.6
4.2R CCCGTTGGATCTTCTCATTTCCC 0.8
α2R AGACCAGGAAGGGCCGGTG 0.1

PCR, polymerase chain reaction.

Disorders of coagulation

Thrombophilia

Considerable advances have been made in our understanding of the genetic risk factors found in patients with venous thromboembolism (VTE).17 Among these are the diverse mutations causing protein C, protein S and antithrombin deficiency. An increased factor VIII level is also a risk factor for VTE, but the genetic determinants of this are unclear. Homozygosity for the common C677T mutation of the methylenetetrahydrofolate reductase gene, which gives rise to a thermolabile variant of this protein, has been reported to be a risk factor for VTE, although other studies have not supported this claim. A point mutation in the 3′ UTR of the prothrombin gene associated with elevated protein levels has been identified as a genetic risk factor for VTE.18 The most common of the known genetic risk factors for VTE is a resistance to the anticoagulant effect of activated protein C caused by the Arg506Gln substitution in factor V (factor V Leiden, FVL);19 around 20% of subjects of north European origin presenting for the first time with thromboembolism are heterozygous for this mutation. Because of their prevalence and because the tests have become relatively simple, there is a tendency toward indiscriminate testing for these genetic risk factors in thrombophilia, but without careful and informed counselling this may often be inappropriate (see also Chapter 19).20

Interpretation

The results can be evaluated using the allelic discrimination plots for the individual genotyping assays. Each data point represents one sample and they can be seen to fall into four clusters according to the genotype of the sample or the absence of the signal in the non-template control (NTC): see Figure 8.5. If the assay has worked, these clusters should be clearly distinct. An automatic genotype annotation is then based on this clustering. Some points will not be automatically called by the software: these data points can be annotated manually by assigning them to the appropriate cluster.

Haemostatic Disorders

Diverse mutations underlie haemophilia A and haemophilia B and these are usually identified in specialized laboratories by screening exons for mutation by single-stranded conformational polymorphism analysis (SSCP), denaturing high-performance liquid chromatography or direct DNA sequence analysis.21 It may still be relevant to determine carrier status and offer prenatal diagnosis through genetic linkage analysis. Problems with this include the number of sporadic cases, lack of informative markers, unavailable family members and the possibility of recombination.

Of particular diagnostic significance is the fact that from between one-third and one-half of all patients with severe haemophilia A have a large genomic inversion mutation involving recombination between a region in intron 22 of the factor VIII gene and telomeric homologous sequences.22 These inversions are readily detected by Southern blot analysis using the p482.6 probe23 to Bcl I digests of genomic DNA. A method has also recently been described using long-distance PCR, enabling identification of these inversion mutations in a single tube reaction (see Chapter 18 for more information on bleeding disorders).24

Leukaemia and lymphoma

Cytogenetic Principles and Terminology

Cytogenetic analysis is usually carried out by specially trained cytogeneticists in a separate laboratory that often has no specific relationship to the haematology laboratory. For this reason, no details of techniques will be given. However, cytogenetic analysis is so crucial to the diagnosis and management of haematological neoplasms that it is necessary for haematologists to understand the principles and be able to understand the reports that are received. In addition, haematologists are often involved in collection of appropriate samples.

Classical cytogenetic analysis is carried out on cells that have entered mitosis and have been arrested in metaphase so that individual chromosomes can be recognized by their size and their banding pattern following staining (e.g. Giemsa staining [G-banding] or staining with a fluorescent dye). Alternating dark and light bands are numbered from the centromere toward the telomere to facilitate description of any abnormalities detected. An example showing the balanced translocation t(9;22)(q34;q11) in chronic myelogenous leukaemia (CML) is shown in Figure 8.6. The standard terminology applied to chromosomes is shown in Table 8.2.

Table 8.2 Terminology and abbreviations used in classical cytogenetic analysis

Term Abbreviation Explanation
Centromere cen The junction of the short and long arms of a chromosome
Telomere ter The termination of the short or long arm of a chromosome, pter or qter
Long arm q The longer of the two arms of the chromosome that are joined at the centromere
Short arm p The shorter of the two arms of the chromosome that are joined at the centromere
Diploid   Having the full complement of 46 chromosomes, 44 paired autosomes and two sex chromosomes in a cell or clone
Haploid   Having 23 chromosomes, a single copy of each autosome and either an X or a Y chromosome in a cell or clone
Tetraploid   Having a total of 92 chromosomes, four of each autosome and four sex chromosomes in a cell or clone
Aneuploid   Having a chromosome number that is neither diploid nor a fraction or a multiple of the diploid number, in a cell or clone
Pseudodiploid   Having 46 chromosomes in a cell or clone but with either structural abnormalities or with loss and gain of different chromosomes so that not all chromosomes are paired
Hyperdiploid   The presence of more than 46 chromosomes in a cell or clone
Hypodiploid   The presence of fewer than 46 chromosomes in a cell or clone
Monosomy − (a minus sign before the chromosome number, e.g. −7) Loss of one of a pair of chromosomes
Trisomy + (a plus sign before the chromosome number, e.g. +13) Gain of a chromosome so that there are three rather than two copies
Deletion del or a minus sign after the number and the designation of the arm of a chromosome, e.g. del(20q) or 20q− Loss of part of the long or the short arm of a chromosome
Translocation t Movement of a chromosomal segment or segments between two or more chromosomes; a translocation can be reciprocal or non-reciprocal
Reciprocal translocation   Exchange of segments between two or more chromosomes
Non-reciprocal translocation   Movement of a segment of a chromosome from one chromosome to another but without reciprocity
Balanced translocation   A translocation that occurs without loss of chromosomal material or at least without loss of sufficient chromosomal material to be detectable by microscopic examination of chromosomes
Unbalanced translocation   A translocation that is associated with gain or loss of part of a chromosome
Inversion inv The inversion of a part of a chromosome, either pericentric or paracentric
Pericentric inversion   An inversion that follows breaking of both the long and short arms so that the part of the chromosome that is inverted includes the centromere
Paracentric inversion   An inversion that follows the occurrence of two breaks in either the long or the short arm of a chromosome so that the part of the chromosome that is inverted does not include the centromere
Insertion ins The insertion of a segment of one chromosome into another chromosome or into a different position on the same chromosomes. Can be direct or inverted
Isochromosome i A chromosome with two long arms or two short arms joined at the centromere, e.g. i(17q)
Derivative der A chromosome that is derived from another; a derivative chromosome derived from two or more chromosomes carries the number of the chromosome that contributed the centromere
Duplication dup The duplication of part of a chromosome
Clone   A population of cells derived from a single cell; in cytogenetic analysis a clone is considered to be present if two cells share the same structural abnormality or extra chromosome or if three cells have lost the same chromosome
Marker mar An abnormal chromosome of uncertain origin that ‘marks’ a clone
Constitutional c A chromosomal abnormality that is part of the constitution of an individual rather than being acquired, e.g. +21c in Down syndrome

The results of cytogenetic analysis may be displayed visually (a karyogram) or written according to standard conventions (a karyotype). Thus, 46,XY,t(3;3)(q21;q26)[20] indicates a pseudodiploid karyotype in a male; a reciprocal translocation has occurred between the paired chromosomes 3, following a break at 3q21 on one chromosome (i.e. involving the long arm of chromosome 3, band 2, sub-band 1) and at 3q26 on the other. The abnormality has been detected in 20 metaphases. 46,XY,inv(3)(q21q26) indicates a pseudodiploid karyotype with a paracentric inversion of the long arm of a single chromosome 3; the breakpoints are the same as in the first example but are on a single chromosome. Note the use of semicolons in describing a translocation, whereas these are absent from the notation of an inversion. Numbers shown within square brackets in a karyotype indicate the number of cells showing the specified normal or abnormal finding. Cytogenetic analysis can be carried out on the following:

In studying suspected haematological neoplasms, there are two reasons for seeking to detect constitutional abnormalities. First, there may be a constitutional abnormality underlying a haematological neoplasm as when megakaryoblastic leukaemia occurs in Down syndrome. Second, there may be an irrelevant and previously undetected constitutional chromosomal abnormality that has to be recognized so that it can be distinguished from an acquired chromosomal abnormality associated with a neoplastic process.

The indications for cytogenetic analysis in a definite or suspected haematological neoplasm are as follows:

For investigation of haematological neoplasms, a bone marrow aspirate is usually the preferred tissue. It is also possible to disaggregate bone marrow cells from a trephine biopsy specimen into tissue culture medium. Peripheral blood may yield metaphases when large numbers of immature cells are present, but it is generally less reliable than the bone marrow in yielding dividing cells. In theory, any infiltrated tissue can provide cells that can be disaggregated and analysed. In haematological practice it is mainly lymph node cells that are studied, but clinically relevant information is sometimes obtained from other infiltrated tissues.

A bone marrow aspirate for cytogenetic analysis should be anticoagulated by the addition of preservative-free heparin or tissue culture medium containing heparin. It can be stored at room temperature for some hours or at 4°C if delay in analysis is expected. If it is being sent to a central laboratory, detailed clinical and haematological information must accompany the sample so that the central laboratory is aware if there is clinical urgency in obtaining results and so that appropriate techniques are used.

Fluorescence in situ Hybridization

Fluorescence in situ hybridization (FISH) bridges classical cytogenetic analysis and molecular diagnostic techniques. Chromosomes can be stained and visualized but the technique is also dependent on the recognition of specific DNA sequences by means of a fluorescent probe that can anneal to a specific DNA sequence. FISH can be carried out on metaphase preparations or on cells in interphase. FISH probes may identify the following:

The main disadvantage is that only those abnormalities that are specifically sought will be found, whereas conventional cytogenetic analysis permits all chromosom’ses to be evaluated.

Translocations, Molecular Analysis and Minimal Residual Disease

The accurate characterization of haematological malignancies at the chromosomal and molecular level has advanced greatly in recent years and now makes an important contribution to initial treatment decisions. For example, many patients with acute leukaemia, CML and non-Hodgkin lymphoma have specific chromosomal lesions known to be associated with particularly favourable or unfavourable prognoses and the proportion of such patients with defined chromosomal lesions is increasing. The presence of a specific molecular abnormality may indicate the need for specific treatment (e.g. all-trans-retinoic acid [ATRA] or As2O3 when PML–RARA is detected or the use of a tyrosine kinase inhibitor when BCR–ABL1 is detected). Usually cytogenetic abnormalities indicate the molecular lesion that is present, but in some cases molecular techniques are more informative.

The Philadelphia (Ph) chromosome (22q−) present in 95% of cases of CML may be identified by routine cytogenetic studies; its presence can be confirmed by demonstrating the presence of the BCR–ABL1 fusion gene by RT-PCR. The Ph chromosome may also be found in 25% and 5% of adult and childhood ALL, respectively,25 where it is associated with relatively poorer prognosis and indicates the need for specific therapy including a tyrosine kinase inhibitor. Patients suspected of having CML should be tested for BCR–ABL1 for definitive diagnosis. Patients with apparent essential thrombocythaemia who do not have a JAK2 mutation should also be tested for BCR–ABL1. To optimize clinical management, patients with ALL should likewise be tested for BCR–ABL1; in adult patients this should be regarded as an essential investigation.

Small cleaved lymphoid cells are observed in a number of conditions with different treatments and prognoses. In such cases, detection of t(11;14) involving CCND1 indicates mantle cell lymphoma, whereas identification of t(14;18) involving BCL2 implies a follicular lymphoma.26 The former is much more aggressive with poor prognosis, thus requiring a more intensive treatment. Translocations associated with lymphomas often lead to the dysregulation of a normal gene: for example t(14;18) places the BCL2 gene adjacent to the IGH locus, leading to dysregulation of BCL2. In contrast, the acute leukaemia-associated translocations often give rise to a chimeric gene that is transcribed: for example t(15;17), which yields a novel PML–RARA fusion gene.27

Frequently, the breakpoints within the translocation are too far apart to allow direct amplification of DNA by PCR. In such cases, the mRNA from the fusion gene can be reverse transcribed using RT to yield cDNA, which can then be amplified by PCR. In addition, RT-PCR is an exquisitely sensitive tool that has been exploited in the detection of residual disease.28 We will illustrate this in the analysis of the BCR–ABL1 fusion gene and describe the analysis of other translocations on p. 168.

BCR–ABL1 Reverse Transcriptase-Polymerase Chain Reaction

Principle and Interpretation

The BCR–ABL1 analysis is performed by two-stage RT-PCR. The RNA extracted from nucleated cells is reverse transcribed by RT to generate coding or cDNA using random primers 6 bp long (hexamers). Following the RT step, the samples are subjected to multiplex PCR, to test for the presence or absence of BCR–ABL1.29 Multiplex PCR is similar to conventional PCR but includes more than one pair of primers in a single PCR test. This strategy enables the detection of the vast majority of the BCR–ABL1 transcripts. The most commonly observed transcripts are b3a2 (e14a2), b2a2 (e13a2) and e1a2, giving rise to 385, 310 and 481 bp amplicons, respectively (Fig. 8.8). However, the identification of fragments of different sizes may be indicative of the presence of a ‘variant fusion gene’ such as e6a2 (1125 bp), e6a3 (951 bp), e8a2 (1319 bp), e8a3 (1145 bp) or e19a2 (908 bp).

In addition to BCR–ABL1, the normal BCR gene is co-amplified, yielding an 808 bp amplicon. The co-amplification of BCR is an indication of the quality of RNA and the efficiency of cDNA synthesis. Absence of any fragments indicates failure of the procedure. The latter is often the result of an aged sample (i.e. more than 72 h old). For RT-PCR analysis, the sample should be processed to lysate stage (see Nuclear lysate preparation, below) within 48 h of collection. In addition, the BCR fragment is often not observed in diagnostic samples where the BCR–ABL1 is preferentially amplified.

If BCR–ABL1 is undetectable by multiplex PCR in follow-up samples from patients undergoing therapy, the cDNA is tested at higher level of sensitivity by nested PCR.30 Nested PCR enables the detection of one leukaemic cell in a background of 105 to 106 normal cells. The choice of primers for nested PCR is dependent on the type of transcript detected by multiplex PCR at presentation. The primers for e14a2 and e13a2 are the same; however, for e1a2 transcript a different set of primers is used. The nested PCR yields fragments of 385 bp (e14a2), 310 bp (e13a2) or 481 bp (e1a2) in length. Nested PCR is not indicated for testing cDNA from a patient suspected of having CML. Diagnosis is made by expression of BCR–ABL1 by multiplex PCR. Furthermore, in post-therapy samples this will indicate molecular relapse.

Methods

Nuclear lysate preparation

RNA extraction

There are several protocols, including commercially available kits, yielding RNA of varying qualities. Qiagen extraction columns are used in our laboratory. The protocol described in the following, originally described by Chomczynski and Sacchi,31 can easily be applied in a clinical laboratory.

Multiplex PCR

Add 2 μl of cDNA to 20 μl of multiplex PCR mix (Table 8.3); add 0.5 u of Taq polymerase. Overlay with 1 drop of mineral oil and amplify using conditions as described in Appendix A. Carry out electrophoresis on the PCR products through 2.0% agarose gel containing SYBR Safe dye.

Nested PCR

Transfer 1 μl of the PCR products from the first-step to 19 μl of the second-step PCR mix (Table 8.3). Overlay with 1 drop of mineral oil and amplify using an annealing temperature of 64°C for 50 s. Then electrophorese the PCR products through 2.0% agarose gel containing SYBR Safe dye. The procedure for nested PCR is the same for both p210 (b3a2 and b2a2) and p190 (e1a2).

Monitoring Minimal Residual Disease

Effective clinical management of haematological malignancies depends on accurate and precise measurement of a patient’s response to therapeutic agents. This includes examination of cellular morphology in peripheral blood and marrow specimens. Although these studies are essential, they lack sensitivity; therefore, the malignant clone has frequently expanded considerably before relapse is recognized. The last three decades have seen a remarkable advance in the development of technology to monitor patients’ response to therapy to a sensitivity of 1 in 105 (i.e. the detection of one malignant cell in a background of 100 000 normal cells). To enable this, a disease-specific marker is essential, as illustrated by targeting the novel fusion gene BCR–ABL1, which maps to the Philadelphia chromosome associated with CML. The principal aim is to detect and measure MRD using the most sensitive techniques available to a clinical laboratory with accuracy and precision and thus recognize early signs of relapse. The clinical utility of such studies has been amply confirmed by close and regular measurement of MRD in patients with CML. This is increasingly being shown to apply to other adult and childhood leukaemias using disease-specific markers.

For purposes of clarity and because of space limitation, we will focus on CML to describe the principle and aims of MRD studies. Although qualitative PCR (i.e. multiplex and nested PCR; see above) is very useful, it provides no information about the kinetics of the disease. The latter can only be obtained by measuring the tumour load; this is achieved by quantification of BCR–ABL1 mRNA molecules.

Because the amount of total RNA added to each reverse transcription reaction and its quality (i.e. the degree of degradation) are variable, the transcripts of a housekeeping gene are quantified as an endogenous control. Furthermore, amplification of an endogenous control gene also allows for the inter-sample PCR dynamics variation. There are a number of control genes that can be used as endogenous control genes (e.g. GAPDH, B2M2-microglobulin) and ABL1). An endogenous control gene should not be too highly expressed and should show no inter-sample variation in levels of expression; also, there should be no related pseudogenes or alternative splicing.32 The introduction of real-time quantitative reverse transcriptase PCR (qRT-PCR) at the end of the last millennium made quantification of MRD more widely accessible.

Principle

qRT-PCR permits quantification of number of transcripts of gene of interest at high levels of sensitivity. This is achieved by developing a technology that permits the detection of PCR products as they accumulate. Furthermore, the rate of accumulation is proportional to the number of mRNA molecules of the target gene in the starting material during the exponential phase of the PCR. The accumulation of amplicons is detected by including a sequence-specific probe labelled with fluorochromes in addition to the primers as in a conventional PCR (Fig. 8.9). Since the advent of qRT-PCR several types of probes have been developed, although all are dependent on the fluorescence resonance energy transfer (FRET) principle. The two commonly used systems involve hybridization or hydrolysis of the probe. A widely used methodology is TaqMan, which involves hydrolysis of the probe.33 This technology is based on the 5′ exonuclease assay, which exploits the inherent 5′ to 3′ exonuclease activity of the Taq DNA polymerase.34 The Taq DNA polymerase cleaves a dual-labelled probe annealed to the target sequence during PCR amplification (Fig. 8.10A). Briefly, the cDNA synthesized from total RNA is added to the PCR reaction containing standard PCR components plus a probe that anneals to the template between the two primers as per conventional PCR. The probe has a fluorescent reporter dye, FAM, at the 5′-end (6′carboxyfluorescein; emission λmax = 518 nm) and quencher dye, TAMRA, at the 3′-end (6-carboxy-tetramethyl-rhodamine; emission λmax = 582 nm). While the probe is intact, the proximity of the quencher greatly reduces the fluorescence emitted by the reporter dye by Förster resonance energy transfer (FRET).35 Adequate quenching is observed for probes with the reporter dye at the 5′ end and the quencher at the 3′ end.

Thus, while TAMRA and FAM are closely attached to the probe, fluorescence from the reporter dye is quenched by TAMRA. During PCR, as the Taq DNA polymerase replicates the DNA strand to which the TaqMan probe is annealed, the probe is degraded by the intrinsic 5′–3′ exonuclease activity of the polymerase. The effect is to dissociate FAM from TAMRA; therefore FRET is no longer applicable and fluorescence from FAM can be detected by a laser integrated in the sequence detector (TaqMan ABI 7500 Real-Time PCR system, Applied Biosystems, Warrington). Fluorescence increases in each cycle, proportional to the rate of probe degradation. The number of cycles taken for the fluorescence to cross a threshold value of 10× the standard deviation of baseline emission is used for quantitative measurement. The threshold is set significantly above the baseline and can be adjusted manually. The upper baseline limit can be altered by the operator. The fluorescence is plotted as ΔRN against number of cycles (Fig. 8.10B), where ΔRN = (Rn+)–(Rn). The Passive reference, ROX (6-carboxy-X-rhodamine), is included in the qRT-PCR Universal master mix. The formulae used to calculate the Rn+ and Rn follow:

From PCR with template :

image

and from PCR without template or early cycles of PCR:

image

The number of cycles taken to pass the defined threshold is called the cycle threshold (Ct) and it is inversely proportional to the quantity of target starting material. The number of transcripts of the target is read off a standard curve. The quantity of target gene and endogenous control gene transcripts are measured off their respective standard curves, generated from dilutions of the appropriate plasmids and run on each plate. The level of expression of the target gene is then reported as a percentage ratio of the target gene to the control gene to obtain a normalized value for the gene of interest independent of the integrity of the RNA and efficiency of the reverse transcription reaction.

Interpretation

Patients who achieve complete cytogenetic remission may still harbour up to 1 × 1010 leukaemic cells. The kinetics of the leukaemic load in these patients and their response to therapeutic agents can only be monitored by measuring MRD.36 However, it should be noted that patients in whom qRT-PCR fails to detect BCR–ABL1 may still harbour up to 1 × 106 leukaemic cells. Of those who are in complete cytogenetic remission (BCR–ABL1/ABL1) × 100 is invariably <2.0%. Investigators previously reported that patients who achieve (BCR–ABL1/ABL1) × 100 <0.045% while receiving α-interferon therapy have a considerably reduced risk of cytogenetic relapse.37 More recently, qRT-PCR has been used to monitor patients being treated with imatinib. An international multicentre study showed that a 3 log reduction in BCR–ABL1 copies was consistent with a good prognosis.38 Quantification of BCR–ABL1 also helps to identify patients at risk of relapse and therefore provides a window for early clinical intervention with the aim of reversing disease progression. For patients who have undergone stem cell transplantation (SCT) this generally means infusion of lymphocytes isolated from the original donor (i.e. adoptive immunotherapy). Although there is some debate as to the precise criteria for molecular relapse, there is little doubt that a confirmed 1 log increase in BCR–ABL1 transcripts is clinically significant (i.e. from 0.002% to 0.02%). Patients who achieve a 0.02% BCR–ABL1/ABL1 ratio on three consecutive occasions are said to be in molecular relapse.

Advantages of qRT-PCR

The major advantage of qRT-PCR is the ability to detect accumulation of amplicons during the exponential phase of PCR. This permits quantification of the DNA of interest in the starting material. This is not possible with conventional PCR because samples are analysed at the end of the PCR run and therefore any differences in the copy number between samples in the starting material are generally not discernible. This is illustrated by the amplification plot shown in Figure 8.10B, where all the samples at the end of 50 cycles have the same level of fluorescence, despite having varying target copy numbers in the starting material as seen in the exponential phase of the PCR. Post-PCR handling is eliminated. On completion of an assay, the sealed microtitre plate is discarded, thereby minimizing risk of contamination. This also eliminates the need to handle stained gels on completion of the qRT-PCR assay. The qRT-PCR offers a higher level of specificity because, in addition to primers annealing to DNA sequence of interest, a third oligonucleotide (the probe) anneals to the region between the primers at a higher temperature. To achieve a level of sensitivity that is similar to qRT-PCR, nested conventional PCR is required, but this is associated with a greater risk of contamination. Conventional PCR is also less amenable to automation. More importantly, because qRT-PCR can be automated, inter-laboratory standardization becomes feasible when measuring patients’ responses to therapy. This permits rapid evaluation of new therapeutic modalities because methodology and protocols can be standardized, permitting international inter-laboratory studies.

With the aim of administrating an optimum dose it is critical to ensure negligible inter-laboratory variation as patients move from one place to another. This would also assist in simplifying multicentre therapeutic agent clinical trials as best illustrated by International Normalized Ratio (INR) for prothrombin time, used to monitor patients whose coagulation status is controlled with the anticoagulant warfarin. There have been efforts to establish a single internationally recognized scale for monitoring CML patients and this may be soon achieved by the establishment of a calibrated and accredited primary reference reagent for BCR–ABL1 q-PCR assays.39

Reagents

×2 Universal master mix. The ×2 Universal master mix contains dATP, dCTP, dGTP and dTTP at 200 μmol/l each, 5.5 mmol/1 MgCl2 and 0.025 μmol/l AmpliTaq-Gold. It also contains the passive background reference dye, ROX. The Universal master mix can be purchased with or without uracil DNA glycosylase, which degrades any PCR contaminating products prior to starting the PCR by heating the plate to 95°C for 10 min (see later). It is possible to assemble master mixes by purchasing various components, such as dNTP, buffer, MgCl2 and hot start Taq DNA polymerase. However, in-house preparation of master mixes is not recommended to minimize intra-assay and inter-assay variation and contamination, essential for monitoring patient response to therapy.

Probe–Primer mix. For convenience and to minimize inter-assay variation a bulk preparation of the qRT-PCR assay mix, containing the probes and primers at required concentration, minus the master mix, is recommended. The mixture is stored at –20°C or –70°C. This also avoids repeated freezing and thawing of probes and primers because this may affect the probe–primer integrity. Furthermore, the probe should not be left exposed for prolonged periods to direct sunlight because this leads to degradation. In general 300 nmol/l of each primer and 200 nmol/l of probe permits optimum qRT-PCR sensitivity; however, this should be determined for each assay by titrating one primer against the other. The optimum concentration of the primers is one that gives the lowest Ct. Similarly; the optimum probe concentration is determined by varying the quantity of the probe. The quantity yielding the lowest Ct is the optimum probe concentration. The probe–primer mixture is then prepared using the determined optimum concentrations. The mixture can then be aliquoted into microcentrifuge tubes for a required number of samples, allowing for standards and positive and negative controls. Furthermore, for MRD studies it is advisable to measure the target gene in replicates of three to minimize sampling error at low copy number values. Because the endogenous control gene copy number is expected, assays in duplicate will suffice. However, standards for the endogenous control should be performed in triplicate.

Designing probe and primers. The probe and primers are designed using Primer Express Software (Applied Biosystems, Foster City, CA). Optimum design of probes and primers is critical to the sensitivity of qRT-PCR. The probe is designed such that it has higher Tm than the primers and works optimally at default PCR conditions settings using the universal master mix. The probe should not have a guanine base at the 3′ end and the number of guanine bases should be fewer than the number of cytosine bases. Furthermore, there should not be more than four guanine bases in tandem. Similar rules apply to design of primers. The annealing temperature of the probe should be 10°C greater than that of the primers. It is essential to design probes and primers such that the assay is RNA specific. This is achieved by positioning the forward and reverse primers in separate exons or by placing either of the primers or the probe across a splice site.

Standard curve. It is acceptable to report data as Ct, with an increase of 3.3 being clinically significant, because this represents 1 log increase in BCR–ABL1 copies; it takes 3.3 cycles for every log increase in amplicons. For clinical samples, however, it is essential to generate a standard curve from which the unknown test samples can be calculated. The standard curve can be generated using serially diluted cDNA derived from a cell line expressing the target gene at high levels (e.g. K562 for BCR–ABL1). As an alternative to using cDNA, a plasmid can be used to create this curve, which provides stability over time. The method of preparation of the plasmid is beyond the scope of this book. Serially diluted plasmids for commonly occurring fusion genes and endogenous control genes are commercially available. In the absence of a standard curve the MRD values are reported as a delta-delta Ct (ΔΔCt). This is calculated by first normalizing the fusion gene Ct (CtFG) to the control gene (CtCG) to obtain a ΔCt for the follow-up samples – that is, the ΔCt(follow-up) = CtFG – CtCG. The same calculation is performed for the Ct value for the sample taken at diagnosis to obtain a ΔCt(diagnosis). The ΔCt(diagnosis) is then subtracted from the ΔCt(follow-up) to obtain a ΔΔCt. From this the MRD value is calculated as 10ΔΔCt/3.3. To apply the ΔΔCt method of reporting the slope and intercept values for the control and fusion genes must be similar. More precisely it is recommended that the slope values for the fusion and control gene should not differ by more than 0.01 (i.e. the PCR efficiency for CG and FG are similar). The major advantage of using ΔΔCt is it obviates the need for a standard curve. Therefore, eliminating the need for a plasmid- or RNA-based standard curve reduces the risk of contamination further and frees microtitre plate wells for patient samples.

PCR cycling conditions. It is convenient to design the probes and primers so that they are able to work efficiently using standard qRT-PCR conditions to amplify the cDNA, which are 2 min at 50°C (to allow uracil DNA glycosylase-mediated elimination of exogenous PCR product contamination), an enzyme heat-activation step of 10 min at 95°C, followed by 50 cycles of 15 s at 95°C for denaturation and 1 min at 60°C for annealing and extension.

Method

The qRT-PCR assay is normally performed in 96-well microtitre plates in a 25 μl final reaction volume containing universal master mix. The composition of a 25 μl qRT-PCR reaction is shown in Table 8.4.

The instrument sets the threshold at ×10 the standard deviation of baseline emission; however, this can be reset manually within the exponential phase of the PCR to avoid any background fluorescent interference. Alternatively, the threshold can be set at the same value for each assay, for instance, at 0.05, assuming this is within the exponential phase of PCR, thus avoiding operator variation. The data for any samples with a Ct >38 are considered unreliable.

The baseline limits are set by the instrument; however, this should be adjusted so that the upper limit of the baseline is 4 cycles less than the lowest Ct value for a sample. For example, if the lowest Ct is 20, then the upper baseline limit is set at 16, thus giving a clear margin between the baseline and the samples. The lower limit set by instrument rarely requires adjusting.

The standard curve is generated and accepted if the slope value is between –3.3 and –3.6. A slope value of –3.3 represents 100% PCR efficiency because it takes 3.3 cycles for every log increase in PCR products. Ideally the curve correlation coefficient should not be <0.98. If the standard curve is acceptable, then the copy number for the samples can be recorded. The qRT-PCR for the endogenous control gene is performed similarly using the target-specific probes and primers. On completion of qRT-PCR for target and endogenous control, the data are reported as a percentage (i.e. (BCR–ABL1/ABL1) × 100).

The Lymphoproliferative Disorders

The majority of lymphoproliferative disorders can be readily diagnosed using cytological, histological and immunological techniques. However, in MRD and in certain cases in which the diagnosis is ambiguous, genetic techniques may be useful.28,40 Examples include cases of controversial lineage, lymphomas in which the histology is ambiguous and occult lymphomas. DNA analysis may also help in determining whether a lymphocytosis is monoclonal, oligoclonal or polyclonal. Translocations do occur in these disorders and may be used in monitoring disease, as described for CML earlier. However, the most commonly used markers, because they are more universally applicable, are the rearranged immunoglobulin (IG) and T-cell receptor (TCR) genes.

Principle

This analysis is possible because the IGH@ and TCR genes undergo a rearrangement during the normal differentiation of B and T lymphocytes, respectively, but not during differentiation of other cells. This rearrangement results in a unique fusion of variable, diversity and joining (VDJ) segments, interdigitated by random nucleotide (N region) insertion or deletion. The sequence and length of the DNA at these sites of recombination are therefore characteristic of any particular lymphocyte clone.

For many years, Southern blot analysis was the gold standard for the detection of rearranged IGH@ and TCR genes. For details on how these were performed and interpreted, we refer the reader to previous editions of this book. More recently, because of its simplicity, the small amount of DNA required and potential sensitivity, PCR has been used to detect rearrangement of the IGH@ and TCR genes. Because of the N region diversity, a polyclonal population of cells will give rise to a ladder of various fragment sizes. However, if one clone becomes abnormally large, a discrete fragment size will begin to dominate the products of the PCR – the basis of the so-called ‘fingerprinting’ method for the diagnosis of lymphoproliferative disorders.41 This analysis can be refined using heteroduplex analysis or SSCP gels in which the sequence as well as the size of the amplified product determines its mobility. To gain further sensitivity in following disease, the product of a ‘clonal’ amplification can be sequenced to derive a clone-specific sequence at the site of rearrangement. This sequence can then be used for the design of clone-specific oligonucleotide probes or primers that can be used in ASOH, ARMS or qRT-PCR. This methodology has been used to monitor MRD in lymphoproliferative disorders.42,43

A comprehensive report has been published on the design and standardization of PCR primers and protocols for the detection of IGH@ and TCR gene rearrangements.40 The detection rate of clonal rearrangements is very high, but the comprehensive nature of the test requires 107 primer pairs in 18 multiplex PCR tubes, which are now commercially available. The methods described here are more restricted but more widely applicable.

Method: Immunoglobulin Heavy Chain Gene Rearrangement

To study immunoglobulin gene rearrangement, the locus of choice is the heavy chain gene. A single primer can be used, which will anneal to a consensus sequence shared by all joining (JH) segments. The choice of variable (VH) segment primers is more difficult and for the more comprehensive analysis, primers from all three framework regions for each of the six or seven VH families are used.39 A reasonable starting point, however, is to use the JH primer in conjunction with a different primer derived from a consensus sequence of the framework 1 region for each VH family. These primers are as follows:

PCR buffer I (see above) is used in these reactions, with an annealing temperature of 60°C. The products of the reactions are in the order of 310–350 bp and can be visualized as either a smear or discrete band in high-percentage agarose gels (1.5–2%). However, a better resolution is obtained when the products are resolved by capillary electrophoresis on an automated fragment analyser (e.g. the ABI 3130xl DNA Analyser). Fragments are visualized by attaching a fluorescent label (HEX or FAM or VIC) to the VH primers and reading the peaks of fluorescence as an electrophoretogram or ‘genescan’ Alternatively, the PCR products can be subjected to heteroduplex analysis, denaturing them at 95°C for 5 min and annealing at 50°C for 1 h, prior to electrophoresis in a non-denaturing 6% polyacrylamide gel.

Interpretation

Because of the variable number of nucleotides either removed or added at the point of joining of VDJ segments of the immunoglobulin heavy-chain gene, the distance between V segment and J segment primers will alter accordingly. For the gene to be functional, the reading frame must be maintained and therefore variations in length must be in multiples of 3 bp, although this may not always be the case in acute leukaemias where non-productive rearrangements may occur. The polyclonal population of B cells therefore gives rise to a characteristic ‘ladder’ or Gaussian size distribution, with maximal intensity observed at the median length at its centre. However, if one B-cell clone is abnormally large, it will give rise to a disproportionately intense peak at the size (and using a V primer from the appropriate family) corresponding to the length of VDJ fragment derived from that clone. At presentation of a B-cell malignancy, this band may be the only one visible, confirming the presence of a dominant abnormal B-cell clone. Subsequently, an abnormal intensity of this fragment size in the background of a ladder can be used to monitor the disease.

In heteroduplex analysis, the polyclonal population of B cells will give rise to fragments with many different sequences, which, on denaturing and reannealing, will generate heteroduplexes that will appear as a smear spreading across the gel. If one large B-cell clone is present, however, homoduplexes will form and these will migrate as a discrete fragment with a migration consistent with its size alone.

There are two main problems that can be encountered in this analysis. The first is that the consensus V primers may not amplify all V segments because of mutations in sequence of the region recognized by the primers (either J, V or both). To overcome this problem, primers for the leader region of the V gene and for the constant region of the heavy chain identified by immunofluorescence on the surface of the B-cell clones may be used on cDNA. The distance between the leader primers and the constant regions may be too large for DNA amplification. It is therefore important that in patients with chronic lymphocytic leukaemia (CLL), B-cell lymphomas and myeloma, RNA is also stored from diagnostic samples in case this approach is required. However, it is also important that appropriate diagnostic material is referred for analysis. For instance, lymph nodes in case of lymphomas, bone marrow (BM) in case of myeloma and peripheral blood (PB) in CLL. A BM or PB sample in a case of lymphoma may be totally ‘empty’ of disease and therefore not suitable for this type of investigation.

Another problem encountered, especially in ALL, is the emergence of a subclone or clones during the course of the disease, which may result in a change in the fragment size and family.

Immunoglobulin Heavy Chain and TCR Gene Rearrangements as Targets for Minimal Residual Disease Analysis

The value of detecting residual disease with greater sensitivity than light microscopy, using molecular or immunological techniques, has been extensively evaluated in childhood and adult ALL. Minimal residual disease is defined as the ‘lowest level of disease detectable in patients in CR (i.e. complete remission) by the methods available’ and the newly developed real-time quantitative PCR techniques have revolutionized MRD investigation and patient management. The methodology makes use of the information derived from the cloning and sequencing of the rearranged clonal leukemic clone and the generation of an allele-specific primer able to identify the unique rearrangement belonging to the leukaemic cell with a sensitivity of 1 in 100 000 normal cells. Guidelines for the interpretation of real-time quantitative PCR data in the analysis of minimal residual disease by IGH@/TCR gene rearrangement have been generated by a European study group. These are currently being followed and applied in a large study at international level and we refer the reader to such extensive publications43 for further information.

In brief, these studies in children have concluded that conversion to MRD negativity shortly after induction therapy and maintenance of MRD negativity are prerequisites for long-term disease-free survival and that MRD positivity often precedes clinical relapse.44 In adults also, MRD analysis carried out during induction therapy provides a strong predictor of outcome and should also be applied to harvested BM to exclude patients with detectable leukaemia burden of more than 1:103 normal cells. Finally, predictions of outcome based on MRD analysis in children and adults are more accurate than predictions based on other prognostic indicators, such as age, gender, immunophenotype, presenting white cell count, karyotype and time taken to achieve first CR.4547

The Myeloproliferative Neoplasms

JAK2 Mutation Analysis

In 2005 several groups independently identified a unique mutation in the JAK homology 2 (JH2) pseudokinase domain of the Janus kinase 2 (JAK2) gene in patients with a variety of myeloproliferative neoplasms (MPNs), including polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF).48,49 The mutation was reported in up to 90%, 40% and 25% of patients in the three diseases, respectively, but not in chronic myelogenous leukaemia or in 700 normal controls. It consisted of a G to T substitution at nucleotide 1849 of exon 14, leading to a valine to phenylalanine substitution at codon 617 (V617F). This mutation caused loss of JAK2 auto-inhibition and constitutive activation of the cytoplasmic JAK2 kinase and has become recognized for definitive molecular diagnosis of PV. Until this mutation was identified the distinction between primary and secondary polycythemia was sometimes difficult to establish.

A variety of molecular methods have been employed to establish the presence of this mutation, including direct DNA sequencing, allele-specific PCR, amplification refractory mutation system, real-time quantitative PCR and melting curve analysis as a semi-quantitative method, restriction fragment length polymorphism (RFLP) analysis and pyrosequencing. There are other methods which could be applicable to this type of mutation analysis, including SSCP or denaturing high-performance liquid chromatography (DH-PLC), both of which are technically challenging and labour intensive.

More recently, some relatively rare mutations in the exon 12 of the JAK2 gene have been identified in V617F-negative patients with polycythaemia vera or unexplained erythrocytosis (thus redefined as polycythaemia vera) using PCR and direct DNA sequencing as well as allele-specific PCR. We are currently screening for these mutations by denaturing HPLC analysis, but a full description of this test lies beyond the scope of this chapter and readers are referred to reference 52 for information. For these investigations, granulocytes represent the preferred source for DNA or RNA preparation, but total white blood cells are also commonly used. DNA and RNA are prepared according to the protocols described in other sections of this chapter.

Principle: JAK2 Exon 14 Mutation Analysis

Mutation of exon 14 of the JAK2 gene in MPNs is characterized by a single nucleotide mutation which is identical in all patients carrying this defect. PCR amplification can be designed to exploit the specific annealing of a primer at the 3′ end in single or multiplex conditions. By designing a primer that matches the codon 617 wild-type (G) sequence, the primer will bind and amplify only the wild-type DNA. Conversely, the primer designed to match the mutant sequence (T) will amplify the mutant allele and not the wild type. After the PCR has been carried out, the products can be visualized in several ways. One can simply run the product on a 2% agarose gel and visualize the products by incorporating SYBR Safe dye in the gel and using a UV transilluminator. This methodology is marred by problems, such as possible lack of specificity and false-positive results.

A more successful approach in our hands is the use of primers designed to include a fluorescent label that differs between the wild-type and the mutant primer. The PCR product can then be run on a fragment analyser (the ABI 3130 for instance, Applied Biosystems, Warrington) with the wild-type and mutant allele appearing as two distinct fragments of the expected size in separate channels (Fig. 8.11).

This represents a rapid and cost-effective method for the analysis of large cohort of patients: 100–200 ng of total DNA or 1/20th of a cDNA reaction (normally containing 2 μg of total RNA in a 50 μl final volume reaction) is sufficient for this test, which is described in more detail below.

A different approach, pyrosequencing, is also extensively used in our laboratory for detecting JAK2 mutations. This approach involves the amplification of a fragment containing the nucleotide mutation by PCR using a biotinylated primer. The amplified product is captured on streptavidin-coated beads and is then used as a substrate for sequencing by synthesis at the mutated nucleotide/s. The four nucleotides are added stepwise and – when they are incorporated – a pyrophosphate (PPi) molecule is released. This is subsequently converted to ATP by ATP sulphurylase, which in turn enables a luciferin molecule to become oxidized in a luciferase reaction, producing light in amounts that are proportional to the amount of ATP. Unincorporated nucleotides and ATP are degraded by the apyrase and the reaction can restart with another nucleotide. Therefore the incorporation of the mutant and/or wild-type nucleotide will be captured and converted into a light emission signal, which can be measured and quantified. By comparing the relative intensity of the signal obtained after incorporation of the mutant and wild-type nucleotides, their relative abundance in the target sequence can be established. In this respect, pyrosequencing is a quantitative method and therefore offers a great advantage compared to other methodologies.

Method B: Using pyrosequencing

Primer sequences are as follows. Pyro-JAK2Ex14 Forward: 5′ GAA GCA GCA AGT ATG ATG AGC A 3′; Pyro-JAK2 Ex14Reverse-Biotinylated: 5′-[Btn]TAT AGT TTA CAC TGA CAC CTA GCT-3′; JAK2 SNP (for sequencing): 5′ TTT TAA ATT ATG GAG TAT GT 3′.

This analysis will produce a measurement of the amplification of each product as a percentage of the wild-type and mutated allele. Normally any amplification of the mutated allele above 5% is considered a positive. Between 1 and 5% is borderline and a repeat sample is recommended. Below 1% is reported as negative.

Acute Myeloid Leukaemia

t(15;17)(q22;q21); PML-RARA Fusion Gene

The t(15;17)(q22;q21) translocation, associated with acute promyelocytic leukaemia (APL)(French–American–British – FAB – M3), fuses the PML gene, on 15q22, to the RARA gene on 17q21. The breakpoint cluster region on chromosome 17 localizes within RARA intron 2. Within PML there are three breakpoint cluster regions: breakpoint cluster region 3 (bcr3) in intron 3, bcr2 in exon 6 (rarely in intron 5) and bcr1 in intron 6. At the messenger RNA level, bcr1, bcr2 and bcr3 are also known as the long (L), variant (V) and short (S) isoforms, respectively. Alternative splicing within PML transcripts and the alternative use of two RARA polyadenylation sites are responsible for the production of additional PML–RARA transcripts of different sizes.

There are at least four variant translocations involving the RARA gene, with the same breakpoint, associated with the APL or similar phenotype. The fusion partners are NPM1 at 5q35, ZNF145 (previously PLZF) at 11q23, NUMA1 at 11q13 and STAT5B at 11q11.

As a consequence of the t(15;17)(q22;q21) translocation, both PML–RARA and RARA–PML fusions can be transcribed. While PML–RARA is consistently found in APL patients, RARA–PML is detectable in only 70% of cases. Thus, PML–RARA is most widely used for diagnosis and MRD monitoring in APL. This transcript can be detected by RT-PCR with a sensitivity of 1:104.

The PML–RARA transcript can be detected with increased sensitivity by qRT-PCR compared to semi-quantitative nested/two-round PCR techniques. Accurate quantification can identify patients with an increasing number of transcripts preceding haematological relapse. Patients treated at the time of molecular relapse have 2-year event-free survival (EFS) rates superior to those treated at the time of haematological relapse.

11q23 Abnormalities

Rearrangements involving the MLL (mixed leukaemia lymphoma) gene (previously also called ALL1, HRX or Htrx1) on chromosome 11q23 and multiple partner genes are found in precursor B-ALL, T-ALL, AML, MDS and therapy-related leukaemia. The presence of MLL rearrangements is usually associated with a poor prognosis.

In ALL, the most common translocation partner of MLL is the MLLT2 gene on chromosome 4q21. Between 50% and 70% of infant ALL cases and approximately 5% of paediatric and adult ALL cases are MLL–MLLT2 positive and are associated with a pro-B-ALL (‘null’) phenotype (CD19+, CD34+, terminal deoxynucleotidyl transferase+, cytoplasmic CD79a+, CD10−). There is also frequent expression of myeloid antigens (CD15 and/or CD65).

The MLL and MLLT2 genes are composed of 37 and 20 exons, respectively, and at least 10 different fusion transcripts have been identified due to translocation breakpoints occurring in different introns of both genes. Breakpoints downstream of the MLL exon 9 in adult and paediatric ALL, but downstream of exon 11 in infant ALL and upstream of exon 4 of the MLLT2 gene, are commonly detected by PCR. Differential splicing is a common finding, leading to more than one fusion transcript in some patients. All t(4;11)-positive cases transcribe the MLL–MLLT2 fusion gene, while only 70% of cases transcribe the reciprocal, MLLT2–MLL, product. Interestingly, low levels of the MLL–MLLT2 transcript have been detected in some ALL cases without cytogenetically detectable t(4;11) and in haemopoietic tissues of healthy individuals.

Using a nested PCR strategy, the various MLLT2–MLL transcripts can be identified with a detection limit of 1:104–105. MRD studies have shown that early conversion and persisting MRD negativity is consistently associated with complete cytogenetic remission.

Method and Interpretation

The above three translocations are determined and monitored by amplification of the mRNA, resulting from the fusion gene, as this is leukaemia-specific in the same way as the BCR–ABL1 testing for the t(9;22) (see p. 155 for the preparation of cDNA and conditions of PCR amplification). However, for primers specific for amplification at diagnosis and for qRT-PCR for follow-up samples we follow the protocols and guidelines for interpretation of results provided by the Europe Against Cancer Consortium.51,52

It is worth noting that due to the multiplicity of the MLL–MLLT2 fusion products and the limitations of hydrolysis probe amplicon size, a genomic DNA-based assay may be employed for following affected patients as previously described.53 This involves the characterization of the individual breakpoint by direct sequencing and designing an ASO in a manner similar to that for Ig/TCR-based MRD.54 As controls for amplification we use the Ipsogen plasmids (www.ipsogen.com ). For interpretation of data, we refer to the Europe Against Cancer guidelines.50,51

Interpretation

A 328 bp amplicon using cDNA (R5F–R6R primers; Fig. 8.12) and a 365 bp amplicon when using DNA (and G11F and G12R primers; Fig. 8.12) are detected in the presence of a wild-type allele. The mutant allele gives rise to a larger amplicon of variable size depending on the size of the internal tandem repeat, different in each individual patient. Because the wild-type and mutant amplicons are very similar in size the PCR product is better visualized using a fragment analyser. This offers a more accurate separation of similar-size products but requires one of the primers used in the reaction to be fluorescently labelled. The samples can be reported as ‘wild-type’ or ‘mutated’ depending on the results obtained and the size of the mutant allele should be noted in the report (in bp).

The other common FLT3 mutation (D835) results in the introduction of an EcoRV restriction site absent in the wild-type allele. This facilitates the identification of this mutation by digestion of the PCR product containing this site.

NPM1 PCR-based Mutation Analysis

The nucleophosmin-1 (NPM1) gene maps to chromosome 5q35. The cDNA has a coding sequence equivalent to a protein of 294 amino acids. Nucleophosmin is an abundant nucleolar phosphoprotein constantly shuffling between the nucleus/nucleolus and cytoplasm. NPM1 mutations represent the most frequent gene alteration in AML. More than 26 different NPM1 mutations have been identified, at breakpoint positions from 956 to 971, characterized by simple 1- or 2-tetranucleotide insertions, a 4-base pair (bp) or 5-bp deletion combined with a 9-bp insertion or a 9-bp deletion combined with a 14-bp insertion. NPM1-mutated AML occurs in all FAB categories except French–American–British (FAB) M3. However, the frequency among the FAB subgroups varies: it is lower in M2 (about 20%) and higher in M4 (acute myelomonocytic leukemia, 40–50%), M5a (acute monoblastic leukaemia, 40–50%) and especially M5b (acute monocytic leukemia, up to 90%). In the World Health Organization 2008 classification, NPM1-mutated AML comprises a specific provisional category. The most common NPM1 mutation type, accounting for 75–80% of cases, is referred to as mutation A (NPM1-mutA). NPM1 gene mutations are common in AML with a normal karyotype, occurring in 50–60% of cases. There is a high frequency of FLT3 gene mutations in NPM1-mutated AML, mostly of the internal tandem duplication type. However, no association between NPM1 gene mutations and TP53, NRAS, CEBPA (CCAAT/enhancer binding protein-α) and MLL gene mutations or recurrent genetic abnormalities has been found. These NPM1 alterations have been shown to possess prognostic significance because they appear to identify patients who will respond well to chemotherapy and may not require transplantation.

Host–donor chimerism studies

Following allogeneic stem cell transplantation it is important to monitor the engraftment of donor cells in the host. This can be achieved in a number of ways, one of which is the use of DNA markers. The method of choice is the PCR amplification of short tandem repeat (STR) loci, which, because of their highly polymorphic nature, are likely to give informative differences between any host–donor pair.58

Method

This method has been modified from Mann et al.59 by Griffiths and Mason (pers. comm.). Five primer pairs are used, as listed in Table 8.5. PCR reactions are carried out using buffer III with 1.5 mM MgCl2. Amplification conditions are 94°C for 5 min, then 25 cycles of 94°C for 30 s, 57°C for 1 min and 72°C for 2 min followed by an extension at 72°C for 5 min. Products are then analysed by genotyping as follows. One μl of the PCR product, which may need to be diluted from 1:4 to 1:10 in water, is added to 10 μl of formamide containing the size marker Rox 500 (Applied Biosystems, Warrington) diluted 7.5 μl per 500 μl of formamide, aliquoted into an optical 96-well reaction plate and run on the ABI 3700 DNA analyser (or equivalent). Peaks representing the DNA fragments are visualized with the Genotyper software (Applied Biosystems, Warrington).

References

1 International Human Genome Sequencing Consortium. Initial sequencing and analysis of the human genome. Nature. 2001;409:860-921.

2 Venter J.C., Adams M.D., Myers E.W., et al. The sequence of the human genome. Science. 2001;291:1304-1351.

3 Saiki R.K., Gelfand D.H., Stoffel S., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;239:487-491.

4 Association for Molecular Pathology. Recommendations for in-house development and operation of molecular diagnostic tests. Am J Clin Pathol. 1999;111:449-463.

5 Schwartz M.K. Genetic testing and the clinical laboratory improvement amendments of 1988: present and future. Clin Chem. 1999;45:739-745.

6 Williams L.O., Cole E.C., Lubin I.M., et al. Quality assurance in human molecular genetics testing: status and recommendations. Arch Pathol Lab Med. 2003;127:1353-1358.

7 Harris S., Jones D.B. Optimization of the polymerase chain reaction. Br J Biomed Sci. 1997;54:166-173.

8 Newton C.R., Graham A., Heptinstall L.E., et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 1989;17:2503-2516.

9 Old J.M., Varawalla N.Y., Weatherall D.J. Rapid detection and prenatal diagnosis of β-thalassaemia: studies in Indian and Cypriot populations in the UK. Lancet. 1990;336:834-837.

10 Wallace R.B., Shaffer J., Murphy R.F., et al. Hybridization of synthetic oligodeoxyribonucleotides to PhiX174 DNA: the effect of single base pair mismatch. Nucleic Acids Res. 1979;6:3543-3547.

11 Saiki R.K., Chang C.A., Levenson C.H., et al. Diagnosis of sickle cell anemia and beta-thalassemia with enzymatically amplified DNA and non-radioactive allele specific oligonucleotide probes. N Engl J Med. 1988;319:537-541.

12 Kawasaki E., Saiki R., Erlich H. Genetic analysis using polymerase chain reaction-amplified DNA and immobilized oligonucleotide probes: reverse dot-blot typing. Methods Enzymol. 1993;218:369-381.

13 Old J. Haemoglobinopathies. Prenat Diagn. 1996;16:1181-1186.

14 Clark B.E., Thein S.L. Molecular diagnosis of haemoglobin disorders. Clin Lab Haematol. 2004;26:159-176.

15 Liu Y.T., Old J.M., Miles K., et al. Rapid detection of alpha-thalassaemia deletions and alpha-globin triplication by multiplex polymerase chain reactions. Br J Haematol. 2000;108:295-299.

16 Ryan K., Bain B.J., Worthington D., et al. On behalf of the British Committee for Standards in Haematology. Significant haemoglobinopathies: guidelines for screening and diagnosis. Br J Haematol. 2010;149:35-49.

17 Cumming A.M., Shiach C.R. The investigation and management of inherited thrombophilia. Clin Lab Haematol. 1999;21:77-92.

18 Poort S.R., Rosendaal F.R., Reitsma P.H., et al. A common genetic variation in the 3′-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood. 1996;88:3698-3703.

19 Bertina R.M., Koeleman B.P., Koster T., et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature. 1994;369:64-67.

20 Baglin T., Gray E., Greaves M., et al. British Committee for Standards in Haematology. Clinical guidelines for testing for heritable thrombophilia. Br J Haematol. 2010;149:209-220.

21 Vidal F., Farssac E., Altisent C., et al. Rapid hemophilia A molecular diagnosis by a simple DNA sequencing procedure: identification of 14 novel mutations. Thromb Haemost. 2001;85:580-583.

22 Lakich D., Kazazian H.H.Jr, Antonarakis S.E., et al. Inversions disrupting the factor VIII gene are a common cause of severe haemophilia A. Nat Genet. 1993;5:236-241.

23 Wion K.L., Tuddenham E.G.D., Lawn R. A new polymorphism in the factor VIII gene for prenatal diagnosis of haemophilia A. Nucleic Acids Res. 1986;14:4535-4542.

24 Liu Q., Nozari G., Sommer S.S. Single-tube polymerase chain reaction for rapid diagnosis of the inversion hotspot of mutation in hemophilia A. Blood. 1998;92:1458-1459.

25 Secker-Walker L.M., Craig J.M., Hawkins J.M., et al. Philadelphia-positive acute lymphoblastic leukaemia in adults: age distribution. BCR-breakpoint and prognostic significance. Leukaemia. 1991;5:196-199.

26 Macintyre E.A., Delabesse E. Molecular approaches to the diagnosis and evaluation of lymphoid malignancies. Semin Hematol. 1999;36:373-389.

27 Biondi A., Rambaldi A., Pandolfi P.P., et al. Molecular monitoring of the myl/retinoic acid receptor-α fusion gene in acute promyelocytic leukaemia by polymerase chain reaction. Blood. 1992;80:492-497.

28 Delabesse E., Asnafi V., Macintyre E. Application of molecular biology techniques to malignant haematology. Transfus Clin Biol. 2003;10:335-352.

29 Cross N.C.P., Melo J.V., Lin F., et al. An optimised multiplex polymerase chain reaction for detection of BCR-ABL fusion mRNAs in haematological disorders. Leukaemia. 1994;8:186-189.

30 Lin F., Goldman J.M., Cross N.C.P. A comparison of the sensitivity of blood and bone marrow for the detection of minimal residual disease in chronic myeloid leukaemia. Br J Haematol. 1994;86:683-685.

31 Chomczynski P., Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Annals of Biochemistry. 1987;162:156-159.

32 Gabert J., Beillard E., van der Velden, et al. Standardization and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia – a Europe Against Cancer program. Leukaemia. 2003;17:2318-2357.

33 Menisk E., van de Locht A., Schattenberg A. Quantification of minimal residual disease in Philadelphia chromosome positive chronic myeloid leukaemia patients using real-time quantitative RT-PCR. Br J Haematol. 1998;102:768-774.

34 Holland P.M., Abramson R.D., Watson R., et al. Detection of specific polymerase chain reaction product by utilizing the 5′–3′ exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A. 1991;88:7276-7280.

35 Livak K.J., Flood S.J., Marmaro J., et al. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 1995;4:357-362.

36 Kaeda J., Chase A., Goldman J.M. Cytogenetic and molecular monitoring of residual disease in chronic myeloid leukaemia. Acta Haematol. 2002;107:64-75.

37 Hochhaus A., Lin F., Reiter A., et al. Quantification of residual disease in chronic myeloid leukaemia on interferon-alpha therapy by competitive polymerase chain reaction. Blood. 1996;87:1549-1555.

38 Hughes T., Kaeda J., Branford S., et al. For the International Randomized Study of Interferon Versus STI571 (IRIS) Study Group. Frequency of major molecular responses to imatinib or interferon alfa plus cytarabine in newly diagnosed chronic myeloid leukemia. N Engl J Med. 2003;349:1397-1431.

39 White H.E., Matejtschuk P., Rigsby P., et al. Establishment of the 1st World Health Organization International Genetic Reference Panel for quantitation of BCR-ABL mRNA. Blood. 2010. 10.1182/blood-2010-1182/b06-1182/blood-2010-11291641 [Epub ahead of print]

40 van Dongen J.J., Langerak A.W., Bruggemann M., et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action BMH4-CT98–BMH4-3936. Leukemia. 2003;17:2257-2317.

41 Deane M., Norton J.D. Detection of immunoglobulin gene rearrangement in B lymphoid malignancies by polymerase chain reaction gene amplification. Br J Haematol. 1990;74:251-256.

42 Cave H., van der Werff ten Bosch J., Suciu S., et al. Clinical significance of minimal residual disease in childhood acute lymphoblastic leukemia. N Engl J Med. 1998;339:591-598.

43 van der Velden V.H., Hochhaus A., Cazzaniga G., et al. Detection of minimal residual disease in hematologic malignancies by real-time quantitative PCR: principles, approaches and laboratory aspects. Leukemia. 2003;17:1013-1034.

44 Goulden N., Bader P., van der Velden V., et al. Minimal residual disease prior to stem cell transplant for childhood acute lymphoblastic leukaemia. Br J Haematol. 2003;122:24-29.

45 Patel B., Rai L., Buck G., et al. Minimal residual disease is a significant predictor of treatment failure in non T-lineage adult acute lymphoblastic leukaemia: final results of the international trial UKALL XII/ECOG2993. Br J Haematol. 2010;148:80-89.

46 Giebel S., Stella-Holowiecka B., Krawczyk-Kulis M., et al. Status of minimal residual disease determines outcome of autologous hematopoietic SCT in adult ALL. Bone Marrow Transplant. 2009;45:1095-1101.

47 Gökbuget N., Raff R., Brügge-Mann M., et al. Risk/MRD adapted GMALL trials in adult ALL. Ann Hematol. 2004;83(suppl 1):S129-S131.

48 Baxter E.J., Scott L.M., Campbell P.J., et al. Cancer Genome Project. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet. 2005;365:1054-1061.

49 Steensma D.P., Dewald G.W., Lasho T.L., et al. The JAK2 V617F activating tyrosine kinase mutation is an infrequent event in both ‘atypical’ myeloproliferative disorders and myelodysplastic syndromes. Blood. 2005;106:1207-1209.

50 Denys B., El Housni H., Nollet F., et al. A real-time polymerase chain reaction assay for rapid, sensitive and specific quantification of the JAK2V617F mutation using a locked nucleic acid-modified oligonucleotide. J Mol Diagn. 2010;12:512-519.

51 Gabert J., Beillard E., van der Velden V.H., et al. Standardization and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia – a Europe Against Cancer program. Leukemia. 2003;17:2318-2357.

52 Beillard E., Pallisgaard N., van der Velden V.H., et al. Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using ‘real-time’ quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) – a Europe against cancer program. Leukemia. 2003;17:2474-2486.

53 Reichel M., Gillert E., Breitenlohner I., et al. Rapid isolation of chromosomal breakpoints from patients with t(4;11). Acute lymphoblastic leukemia. Cancer Res. 1999;59:3357-3362.

54 Szczepański T., Willemse M.J., Brinkhof B., et al. Comparative analysis of Ig and TCR gene rearrangements at diagnosis and at relapse of childhood precursor-B-ALL provides improved strategies for selection of stable PCR targets for monitoring of minimal residual disease. Blood. 2002;99:2315-2323.

55 Horiike S., Yokota S., Nakao M., et al. Tandem duplications of the FLT3 receptor gene are associated with leukemic transformation of myelodysplasia. Leukemia. 1997;11:1442-1446.

56 Cazzaniga G., Dell’Oro M.G., Mecucci C., et al. Nucleophosmin mutations in childhood acute myelogenous leukemia with normal karyotype. Blood. 2005;106:1419-1422.

57 Bacher U., Schnittger S., Haferlach T. Molecular genetics in acute myeloid leukemia. Curr Opin Oncol. 2010;22(6):646-655.

58 Van Deerlin V.M., Leonard D.G. Bone marrow engraftment analysis after allogeneic bone marrow transplantation. Clinical and Laboratory Medicine. 2000;20:197-225.

59 Mann K., Fox S.P., Abbs S.J., et al. Development and implementation of a new rapid aneuploidy diagnostic service within the UK National Health Service and implications for the future of prenatal diagnosis. Lancet. 2001;358:1057-1061.

[/level-membership-for-hematology-oncology-and-palliative-medicine-category][not-level-membership-for-hematology-oncology-and-palliative-medicine-category]

Chapter 8 Molecular and cytogenetic analysis

Introduction to the analysis of DNA

Our understanding of the molecular basis of both inherited and acquired haematological disorders is now considerable and there are several ways in which this knowledge is being applied in diagnostic haematology. These include the identification of genetic defects in haemoglobinopathies allowing the provision of early prenatal diagnosis, the assessment of genetic risk factors in thrombophilia, the diagnosis and characterization of leukaemias, the monitoring of minimal residual disease and the study of host–donor chimerism following bone marrow transplantation. In this chapter, we shall describe some of the methods that can be applied in these conditions, although this cannot be exhaustive and will reflect the specific interests of our laboratories.

The ability to manipulate DNA as recombinant molecules followed from the discovery of bacterial DNA-modifying enzymes that allowed genes to be isolated as cloned recombinant DNA molecules and their DNA to be sequenced. The sequence of the human genome is now complete (see: www.ornl.gov/sci/techresources/Human_Genome/project/timeline.shtml).1,2 It has become extensively annotated and is accessible through a number of genome browsers. The ability to amplify specific DNA fragments from small amounts of starting material using the polymerase chain reaction (PCR)3 is now the cornerstone of most routine DNA analysis. Because this technique is relatively simple, rapid, inexpensive and requires only some basic pieces of laboratory equipment, it has made molecular genetic analysis readily accessible in many laboratories.

Guidelines from the American Association for Molecular Pathology address the choice and development of appropriate diagnostic assays, quality control and validation and implementation of molecular diagnostic tests.4 In the UK, a national external quality assessment scheme has been approved for the molecular genetics of thrombophilia and pilot studies are currently in progress for the molecular diagnosis of haematological malignancies and for haemophilia A. It is true, however, that the development and implementation of quality control methods and assurance standards still lag behind the rapid rate of expansion of molecular techniques.5,6 To overcome this, both at national and international level, several groups are attempting to reach a standardization of molecular methodologies applied to fusion gene quantification (BCR–ABL1, PML–RARA, etc.) in myeloid malignancies as well as the molecular monitoring of residual disease using antigen receptor targets in acute and chronic lymphoid malignancies.

In this chapter, some of the applications of the PCR in a diagnostic haematology laboratory are described. For the reasons just mentioned, the analysis of PCR products has largely superseded other techniques, including Southern blot analysis, and capillary electrophoresis has replaced polyacrylamide gel electrophoresis. For situations in which these are still appropriate, the reader is referred to previous editions of this book.

Extraction of DNA

DNA can be extracted from blood, bone marrow or tissue samples. The quality and quantity of the DNA obtained will vary depending on the size, age and cell count of the sample. As a rule, 5–10 ml of blood in ethylenediaminetetra-acetic acid (EDTA) will suffice. The DNA is extracted from all nucleated cells and is called genomic DNA.

In the nucleus, the DNA is tightly associated with many different proteins as chromatin. It is important to remove these as well as other cellular proteins to extract the DNA. This is achieved through the use of organic solvents, salt precipitation or DNA-affinity columns. An aqueous solution of DNA is obtained, from which the DNA is further purified by precipitation. A number of DNA extraction kits have been developed. They are commercially available and cost-effective. In addition, equipment that can achieve simultaneous extraction from a large number of samples is available and will be discussed below. These can significantly reduce the amount of time required for DNA extraction, bypass the use of organic solvents and provide good quality control of the reagents used.

Polymerase chain reaction

Development of the PCR3 has had a dramatic impact on the study and analysis of nucleic acids. Through the use of a thermostable DNA polymerase, Taq polymerase (available from various suppliers, including Applied Biosystems, Warrington and Thermo-Fisher, Runcorn) extracted from the bacterium Thermus aquaticus, the PCR results in the amplification of a specific DNA fragment such that it can be visualized using intercalating SYBR Safe (Invitrogen, Paisley) added to agarose gels. Ethidium bromide, a carcinogenic product, is no longer in use for safety reasons. The procedure takes only a few hours and requires only a very small amount of starting material.

Principle

A DNA polymerase will synthesize the complementary strand of a DNA template in vitro. A stretch of double-stranded DNA is required for the synthesis to be initiated. This double-stranded sequence can be generated by annealing an oligonucleotide (oligo), which is a short, single-stranded DNA molecule usually between 17 and 22 bases in length, to a single-stranded DNA template. These oligos, which are synthesized in vitro, will prime the DNA synthesis and are therefore referred to as primers.

In the PCR, at least two oligos are used. One primes the synthesis of DNA in the forward direction or along the coding strand of the DNA, whereas the other primes DNA synthesis in the reverse direction or along the non-coding strand. The other components of the reaction are the DNA template from which the DNA fragment will be amplified, the four deoxynucleotide triphosphates (dATP, dTTP, dCTP and dGTP) required as the building blocks of the newly synthesized DNA, a salt buffer containing MgCl2 and the thermostable DNA polymerase (Taq polymerase).

The first step of the reaction is to denature the DNA, generating single-stranded templates, by heating the reaction mixture to 95°C. The reaction is then cooled to a temperature, usually between 50°C and 68°C, that permits the annealing of the primers to the DNA template but only at their specific complementary sequences. The temperature is then raised to 72°C, at which temperature the Taq polymerase efficiently synthesizes DNA, extending from the primers in a 5′ to 3′ direction. Cyclical repetition of the denaturing, annealing and extension steps, by simply changing the temperature of the reaction in an automated heating block, results in exponential amplification of the DNA that lies between the two primers (Fig. 8.1).

The specificity of the DNA fragment that is amplified is therefore determined by the sequences of the primers used. A sequence of 17–22 base pairs (bp) is statistically likely to be unique in the human genome and so primers of this length and longer will anneal at only one specific place on a template of genomic DNA. One general requirement of the PCR therefore is some knowledge of the DNA sequence of the gene that is to be amplified. The relative positioning of the two primers is another important consideration. They must anneal to complementary strands and must prime DNA synthesis in opposite directions pointing towards one another. There is also an upper limit to the distance apart that the oligos can be placed; fragments of several kilobase pairs (kb) in length can be amplified, but the process is most efficient for fragments of several hundred bp.

Reagents

Method

Optimal conditions for the reaction have to be derived empirically, with the magnesium concentration and annealing temperature being the most important parameters.7 The choice of buffer depends on the enzyme being used and the company will usually supply the most appropriate one. For genes with a high GC content, buffer II in combination with 10% DMSO may give better amplification. In most cases, a 25 μl reaction volume suffices. A blank control should always be included (i.e. a reaction without any template) to control for contamination. If the blank control yields a product, the analysis is invalid. A DNA sample that is known to amplify can also be included and this sample may then be used as a normal or positive control.

The risk of contamination cannot be overemphasized. It can be minimized by using plugged tips and having dedicated micropipettes and areas for each step of the analysis. The optimum cycling conditions need to be determined for each thermocycler. Specificity is often improved by ‘hot start’ PCR. This is achieved by setting up all the PCR tests on wet ice and transferring the tubes to the thermocycler once it reaches 95°C or by using an enzyme that only becomes activated when heated at 95°C for several minutes. In preparing a group of reactions, a premix solution is prepared that can be dispensed into microcentrifuge tubes, tube strips or PCR reaction 96-well plates to which the template DNA is added. When a particular PCR is to be performed repetitively over a period of time, it is helpful to prepare a large volume (e.g. 10 ml) of the reaction mixture (without DNA or Taq polymerase), aliquot it and store it at –20°C.

1. Prepare a PCR mixture for 20 reactions (with a final volume of 25 μl for each DNA sample) as follows:

Stock solution Volume (μl) Final concentration
×10 PCR buffer III 50 ×1
25 mmol/l MgCl2 40 2.0 mmol/l
10 mmol/l dNTP 10 0.02 mmol/l
10 μmol/l Primer (1) 20 0.04 μmol/l
10 μmol/l Primer (2) 20 0.04 μmol/l
5 u/μl Taq polymerase 2 0.02 μ/ml
Water 358  
Final volume 500  

Add the Taq polymerase last, mix well and pulse-spin in a microcentrifuge to bring down the contents of the tube.

Problems and Interpretation

If the amplification has been successful, a discrete fragment of the expected size is seen in an SYBR Safe-stained agarose gel in all samples, except where a blank control (in which the DNA template is replaced by water) is loaded. If a product is seen in the blank control, then one of the solutions has been contaminated. In this case, the experiment and all the working solutions must be discarded and the micropipettes must be cleaned. Cleaning micropipettes prior to the start of each experiment is highly recommended. To avoid contamination, setting up a master mix of all reagents is recommended before DNA samples are added to each tube.

Conversely, the absence of a fragment in all tracks indicates that the PCR has failed. This could occur for a number of reasons, the most obvious being the poor quality or omission of one of the essential reagents. The reaction may also fail if the magnesium concentration is too low (standard concentration 1.5 mM) or if the annealing temperature is too high. DNA quality is often one of the major reasons for failure. If one particular DNA sample repeatedly fails to amplify, then the sample should be re-extracted using Proteinase K (Sigma, Poole) and phenol and chloroform and reprecipitated in one-tenth volume of 5 mol/l ammonium acetate or 3M sodium acetate pH 4.8 and 2.5 volumes of ethanol. We have also found that for samples prepared using the Gentra method, passing the DNA through a Qiagen column substantially improves DNA quality and PCR efficiency. Another problem is the presence of non-specific fragments or just a smear of amplified product. This can occur if the magnesium concentration is too high or if the annealing temperature is too low.

Analysis of polymerase chain reaction products

Presence or Absence of a Polymerase Chain Reaction Product

Initially, PCR products are commonly and conveniently visualized by agarose gel electrophoresis. However, it has also become commonplace to visualize PCR products directly on DNA analysers – in particular the Applied Biosystems 3130xl (Warrington) – through the use of a fluorescent label on one of the primers. If appropriate primers and controls are included in an experiment, the actual presence of a product can be highly informative.

Amplification Refractory Mutation System

Principle

Point mutations and small insertions or deletions can be identified directly by the presence or absence of a PCR product using allele-specific primers.8,9 Two different oligos are used that differ only at the site of the mutation (the amplification refractory mutation system or ARMS, primers) with the mismatch distinguishing the normal and mutant base located at the 3′ end of the oligo. In a PCR, an oligo with a mismatch at its 3′ end will fail to prime the extension step of the reaction. Each test sample is amplified in two separate reactions containing either a mutant ARMS primer or a normal ARMS primer. The mutant primer will prime amplification together with one common primer from DNA with this mutation but not from a normal DNA. A normal primer will do the opposite. To increase the instability of the 3′ end mismatch and so ensure the failure of the amplification, it is sometimes necessary to introduce a second nucleotide mismatch three or four bases from the 3′ end of both oligos. A second pair of unrelated primers at a distance from the ARMS primers is included in each reaction as an internal control to demonstrate that efficient amplification has occurred. This is essential because a failure of the ARMS primer to amplify is interpreted as a significant result and must not be the result of suboptimal reaction conditions.

Gap-PCR

Large deletions can be detected by Gap-PCR. Primers located 5′ and 3′ to the breakpoints of a deletion will anneal too far apart on the normal chromosome to generate a fragment in a standard PCR. When the deletion is present, the sites at which these primers anneal will be brought together, enabling them to give rise to a product. An example of this is given for the detection of deletions in α° thalassaemia in Figure 8.4 on p. 149.

image

Figure 8.4 Detection of α° thalassaemia by multiplex Gap-PCR. The sequences of the primers used are shown in Table 8.1. A normal fragment of 1010 bp is generated by the primers α/SEA(F) and α/(R) in all lanes (although this is very faint in lane 11). In addition, a fragment of 660 bp is generated by the primer pair α/SEA(F) and SEA(R) in lanes 1, 4 and 8 in individuals who are heterozygous for the − −SEA deletion; a fragment of 550 bp is generated by the primer pair FIL(F) and FIL(R) in lane 9 in an individual who is heterozygous for the − −FIL deletion; a fragment of 875 bp is generated by the primer pair MED(F) and MED(R) in lane 10 in an individual who is heterozygous for the − −MED deletion; and a fragment of 1187 bp is generated by the primer pair 20.5(F) and 20.5(R) in lane 10 in an individual who is heterozygous for the −α20.5 deletion.

By the same principle, the sites at which primers anneal can be brought together by chromosomal translocation, giving rise to a diagnostic product. Breakpoints may be clustered over too large a region for genomic DNA to be used in these instances. However, leukaemic translocations can also give rise to transcribed fusion genes. Primer annealing sites in different genes are then juxtaposed in a hybrid messenger RNA (mRNA) molecule and can give rise to a reverse transcription-PCR (RT-PCR) product. Examples of this are given for the analysis of minimal residual disease in chronic myelogenous leukaemia (CML) in Figure 8.8 on p. 155.

image

Figure 8.8 Detection of minimal residual disease in chronic myelogenous leukaemia (CML) by reverse transcriptase-polymerase chain reaction (RT-PCR). (A) Diagrammatic representation of the processed exons of the BCR and ABL1 genes together with the relative position of the B2B and C5e-primers used to co-amplify BCR in the multiplex PCR. (B) Commonly observed BCR–ABL1 derivatives, b2a2 and b3a2 which give rise to p210 BCR–ABL1 and e1a2, which gives rise to p190 BCR–ABL1. The relative positions of the primers used to amplify the chimeric transcripts by multiplex PCR are shown. (C) A 2.0% agarose gel containing SYBR Safe dye through which amplicons generated by multiplex PCR using complementary DNA (cDNA) from five patients (lanes 1 to 5) were electrophoresed. The co-amplified normal BCR fragment, 808 bp in length, is seen in all samples except for the lanes containing the blank controls (B). The diagnostic sample from a patient with suspected CML, in lane 2, revealed a fragment corresponding to the b3a2 BCR–ABL1 transcript, 385 bp in length, in addition to the BCR amplicon. BCR–ABL1 is not detectable in lanes 1, 3, 4 and 5 containing follow-up samples from patients following stem cell transplantation (SCT). (D) The cDNA of these individuals was subjected to nested PCR to exclude residual disease. This reveals BCR–ABL1 transcripts, b3a2 (385 bp) and b2a2 (310 bp) in lanes 1 and 4, previously undetectable by the less sensitive multiplex PCR. However, BCR–ABL1 is not detectable in lanes 3 and 5, implying these samples are from patients in molecular remission post-SCT. B, blank controls; K (K562-b3a2) and BV (BV173-b2a2), positive controls; M, molecular size marker.

Restriction Enzyme Digestion

Reagents

A number of companies supply a comprehensive list of restriction enzymes (RE), including New England Biolabs (Hitchin) and Fermentas (York). Those that are in regular use are generally quite inexpensive compared with the more specialized enzymes that are used only occasionally, which may be 10–100 times more expensive. RE buffers are now almost always supplied with each RE. Buffer compositions are always given and will vary from enzyme to enzyme. Many commonly used REs cut perfectly well in a single ‘universal’ buffer. This is prepared using the following stock solutions:

Allele-Specific Oligonucleotide Hybridization

Principle

Under appropriate conditions, short oligonucleotide probes will hybridize to their exact complementary sequence but not to a sequence in which there is even a single base mismatch.10 A pair of oligos is therefore used to test for the presence of a point mutation: a mutant oligo complementary to the mutant sequence and a normal oligo complementary to the normal sequence, with the sequence difference placed near the centre of each oligo.

The stability of the duplex formed between the oligo and the target DNA being tested (the product of a PCR reaction) depends on the temperature, the base composition and length of the oligo and the ionic strength of the washing solution. For allele-specific oligonucleotide hybridization (ASOH) studies, an empirical formula has been derived for the dissociation temperature (Td), the temperature at which half of the duplexes are dissociated: for hybridization of oligonucleotides of 14–20 bases in length. The Td can be estimated as 2°C for each dA:dT pair plus 4°C for each dG:dC base pair. This value is used as a guideline; the exact temperature at which only perfect base pairing is maintained is usually determined by trial and error.

This methodology has been widely applied for the detection of point mutations using fluorescently labelled TaqMan probes that distinguish the two alleles. Two short allele-specific probes are used, one of which will hybridize only to the wild-type allele and one of which will hybridize only to the mutant allele. Each probe is labelled with a different fluorescent colour, which is quenched while the probe remains intact, but is released if and when the probe hybridizes to its perfectly complementary sequence during the PCR reaction, as it will then be broken up by the exonuclease activity of the Taq polymerase. An example of this analysis is the detection of the factor V Leiden mutation in Figure 8.5 on p. 150.

DNA Sequencing

Principle

The Sanger chain termination method for direct DNA sequencing has become a standard diagnostic tool. In many laboratories, this procedure has superseded targeted mutation detection as it provides a robust and relatively rapid method to identify all sequence changes that may be present in a particular DNA fragment. This approach is particularly relevant where multiple different mutations may underlie a particular disorder. This is the case for β thalassaemia, glucose-6-phosphate dehydrogenase (G6PD) deficiency and the red cell membrane disorders among others and so it is not surprising that DNA sequencing has often become the method of choice for the molecular diagnosis of these diseases.

In outline, the method revolves around the de novo synthesis of DNA strands in one direction from a PCR-derived template DNA fragment. The chain is lengthened by a thermostable DNA polymerase using deoxynucleotide triphosphates in the normal way; however, included in the reaction mixture is a small proportion of labelled dideoxynucleotide triphosphates (ddNTPs), which when incorporated will prevent any further extension of the chain. This process happens millions of times along a relatively short piece of DNA (usually up to 1000 bases), which means that chaintermination will occur many times at each position along the fragment. In the Applied Biosystems BigDye system (Warrington), each of the ddNTPs is labelled with a different fluorochrome and so the products of the sequencing reaction will consist of single-stranded DNA fragments, each differing in size by one base pair and each labelled with a different colour. These fragments can then be separated by capillary electrophoresis and the order with which the different colours exit the capillary will correspond to the sequence of the DNA template.

Interpretation

Reading the DNA sequence from a good trace – known as an electrophoretogram – is completely straightforward: As are called as green peaks; Ts as red; Cs as blue; and Gs as black. Free software packages, such as Chromas (at: http://chromas-lite-version.fyxm.net/), are available for viewing these traces and will call the DNA sequence in the file. Simple alignment of this sequence to the GenBank reference sequence can be performed at the National Center for Bioinformatics (NCBI) using the Blast program (at: http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome) and will identify any sequence changes. Heterozygous point mutations will be seen as double peaks, with two colours overlaid. Small heterozygous insertions or deletions (indels) are harder to decipher, as the sequence 3′ of the mutation will be a double sequence, with the normal and indel allele superimposed on one another: the extent of the indel can be defined by subtracting from the expected normal sequence.

Investigation of haemoglobinopathies

β Thalassaemia

The ethnic groups with the highest incidence of β thalassaemia are the Mediterranean populations, Asian Indians, Chinese and Africans. Although more than 100 β thalassaemia mutations are known, each of these groups has its own subset of mutations, so that as few as five different mutations may account for more than 90% of the affected individuals in a population. This makes the direct detection of β thalassaemia mutations a reasonable possibility and it has become the method of choice where it is most important: in prenatal diagnosis.13,14

The majority of mutations causing β thalassaemia are point mutations affecting the coding sequence, splice sites or promoter of the β globin gene. Methods for their detection include either ARMS or reverse dot blot analysis, although more commonly now, they are detected by direct DNA sequence analysis. Unstable and other unusual haemoglobins may also cause disease and can also be identified by direct DNA sequence analysis. An example of such a case is shown in Figure 8.3, where a picture of moderate anaemia is seen in the heterozygote due to the highly unstable and electrophoretically silent variant, haemoglobin, Durham, NC.

α Thalassaemia

In contrast to the β thalassaemias, the most common α thalassaemia mutations are deletions. Two categories exist: those that remove only one of the two alpha globin genes on any one chromosome (α+ thalassaemia) and those that remove both of the alpha genes from one chromosome (α° thalassaemia). Although PCR amplification around the alpha globin locus has proved to be rather difficult, the common deletions can now be identified by a reasonably robust Gap-PCR.15 In these reactions dimethylsulphoxide (DMSO) and betaine are added. Two different multiplex PCR reactions are set up, one for the common α+ thalassaemias (−α3.7 and −α4.2) and one for the common α° thalassaemias (− −SEA, − −MED, − −FIL and −α20.5). The fragment generated by these primers across the deletion breakpoint is different in size to a control fragment that is generated from the normal chromosome as a part of the multiplex reaction. The primers that flank the deletion breakpoint are too far apart to generate a fragment from the normal chromosome in the PCR. Only when these are brought closer together as a result of the deletion can a fragment be produced. Primer sequences used in this analysis are given in Table 8.1 and an example of their application in the detection of α thalassaemias is shown in Figure 8.4. More than 30 non-deletional forms of α thalassaemia have been described. Of these, Hb Constant Spring and the αHphIα mutation are relatively common in South-east Asian and Mediterranean populations, respectively. These can be detected by ASOH, ARMS, restriction enzyme digestion or direct sequencing of the appropriate PCR product. Unlike the β thalassaemias, α thalassaemias are not easily diagnosed using routine haematological techniques. The diagnosis of α thalassaemias is often made following exclusion of β thalassaemia and iron deficiency. Because the vast majority of cases of α thalassaemia are of the clinically benign type (i.e. α+ thalassaemia), it is debatable whether molecular analysis is justified to reach a diagnosis in these individuals. However, it is important that individuals with α° thalassaemia are identified and the only definitive diagnostic test is DNA analysis. The α° thalassaemias are almost entirely restricted to at-risk ethnic groups, particularly those of South-east Asian or Mediterranean origin and so it is most efficient to target these groups specifically. The diagnosis of α° thalassaemia is particularly relevant if prenatal diagnosis is to be offered to a couple who are at risk of having a fetus with hydrops, where there is an increased risk of maternal death at delivery. Guidelines derived from the UK experience as to how and when DNA analysis should be implemented have recently been updated.16

Table 8.1 Primers used in Gap-PCR analysis of α-thalassaemia

Primer name Sequence, 5′→3′ Concentration (μmol/l)
α° Multiplex PCR Clark and Thein (2004)14
20.5(F) GGGCAAGCTGGTGGTGTTACACAGCAACTC 0.1
20.5(R) CCACGCCCATGCCTGGCACGTTTGCTGAGG 0.1
α/SEA(F) CTCTGTGTTCTCAGTATTGGAGGGAAGGAG 0.3
α(R) TGAAGAGCCTGCAGGACCAGGTCAGTGACCG 0.15
MED(F) CGATGAGAACATAGTGAGCAGAATTGCAGG 0.15
MED(R) ACGCCGACGTTGCTGCCCAGCTTCTTCCAC 0.15
SEA(R) ATATATGGGTCTGGAAGTGTATCCCTCCCA 0.15
FIL(F) AAGAGAATAAACCACCCAATTTTTAAATGGGCA 1.6
FIL(R) GAGATAATAACCTTTATCTGCCACATGTAGCAA 1.6
α+ Multiplex PCR From JM Old (pers. comm.)
3.7F CCCCTCGCCAAGTCCACCC 0.4
3.7/20.5R AAAGCACTCTAGGGTCCAGCG 0.4
4.2F GGTTTACCCATGTGGTGCCTC 0.6
4.2R CCCGTTGGATCTTCTCATTTCCC 0.8
α2R AGACCAGGAAGGGCCGGTG 0.1

PCR, polymerase chain reaction.

Disorders of coagulation

Thrombophilia

Considerable advances have been made in our understanding of the genetic risk factors found in patients with venous thromboembolism (VTE).17 Among these are the diverse mutations causing protein C, protein S and antithrombin deficiency. An increased factor VIII level is also a risk factor for VTE, but the genetic determinants of this are unclear. Homozygosity for the common C677T mutation of the methylenetetrahydrofolate reductase gene, which gives rise to a thermolabile variant of this protein, has been reported to be a risk factor for VTE, although other studies have not supported this claim. A point mutation in the 3′ UTR of the prothrombin gene associated with elevated protein levels has been identified as a genetic risk factor for VTE.18 The most common of the known genetic risk factors for VTE is a resistance to the anticoagulant effect of activated protein C caused by the Arg506Gln substitution in factor V (factor V Leiden, FVL);19 around 20% of subjects of north European origin presenting for the first time with thromboembolism are heterozygous for this mutation. Because of their prevalence and because the tests have become relatively simple, there is a tendency toward indiscriminate testing for these genetic risk factors in thrombophilia, but without careful and informed counselling this may often be inappropriate (see also Chapter 19).20

Interpretation

Buy Membership for Hematology, Oncology and Palliative Medicine Category to continue reading. Learn more here

[/not-level-membership-for-hematology-oncology-and-palliative-medicine-category]